báo cáo hóa học:" Tremorgenesis: a new conceptual scheme using reciprocally innervated circuit of neurons" pptx

báo cáo hóa học:" Tremorgenesis: a new conceptual scheme using reciprocally innervated circuit of neurons" pptx

báo cáo hóa học:" Tremorgenesis: a new conceptual scheme using reciprocally innervated circuit of neurons" pptx

... Central Page 1 of 6 (page number not for citation purposes) Journal of Translational Medicine Open Access Editorial Tremorgenesis: a new conceptual scheme using reciprocally innervated circuit of ... tremor Tool Parameter analyzed Clinical scales Clinical scores of disability Videos Clinical characterization of tremor Quantification of drawings Evaluation of tr...

Ngày tải lên: 18/06/2014, 15:20

6 339 0
Báo cáo hóa học: " Melanoma: A model for testing new agents in combination therapies" doc

Báo cáo hóa học: " Melanoma: A model for testing new agents in combination therapies" doc

... Calabresi F, Tonato M, Canaletti R, Boni C, Buzzi F, Ceci G, Corgna E, Costa P, Lottici R, Papadia F, Sofra M, Bacchi M: Treatment of metastatic malignant melanoma with dacarbazine plus tamoxifen. ... for example, combining a DNA repair inhibitor of PARP with a DNA damaging agent may greatly enhance effectiveness in tumors that have already lost one path- way of DNA repair. A st...

Ngày tải lên: 18/06/2014, 16:20

7 450 0
Báo cáo khoa học: GHP, a new c-type green heme protein from Halochromatium salexigens and other proteobacteria potx

Báo cáo khoa học: GHP, a new c-type green heme protein from Halochromatium salexigens and other proteobacteria potx

... of 11 kDa. Amino-acid sequence of GHP and molecular mass The complete amino-acid sequence (Fig. 2) of GHP was determined by a combination of automated Edman degradation and tandem MS of peptides ... chromosome in Ralstonia eutropha, Azoarcus sp., Methylococcus capsulatus, Bordetella pertussis, Methylobacillus flagellatus, and Burkholderia cepacia, but the RNAse, protease, and GTPas...

Ngày tải lên: 08/03/2014, 08:20

11 517 0
Báo cáo khoa học: "TOWARDS A NEW TYPE OF ANALYSE " pptx

Báo cáo khoa học: "TOWARDS A NEW TYPE OF ANALYSE " pptx

... Universfitatis C.aroli, nae: Slavica 2ra~ensia 2. ~. Z.av<~Lov~ Eva. 1~7 =. Re~ro~r~dnf :~orfe:aat~ck~' slovn~,~ ceot~n E [A retrograde morphematicd[ctiona- ry of Czech). Praha: Academia. ... project of man-machine cozununication without a pre-arranged data base (TIBAQ). The kind of morphemic analysis z~resented here is based on a retrograde (right-to-left) analys...

Ngày tải lên: 09/03/2014, 01:20

8 414 0
báo cáo hóa học:" Lentivirus-mediated RNAi silencing targeting ABCC2 increasing the sensitivity of a human nasopharyngeal carcinoma cell line against cisplatin" docx

báo cáo hóa học:" Lentivirus-mediated RNAi silencing targeting ABCC2 increasing the sensitivity of a human nasopharyngeal carcinoma cell line against cisplatin" docx

... 5'-CACCCAGCACAATGAAGAT-3'; ACTB reverse: 5'-CA AATAAAGCCATGCCAAT-3'. Cycling condi- tions were used as described previously [17]: 95°C for 10 min to activate DNA polymerase, followed ... ABCC2-depending cisplatin resistance in NPC. ABCC2 siRNA increased the intracellular accumulation of cisplatinFigure 2 ABCC2 siRNA increased the intracellular accumulation of cisplatin...

Ngày tải lên: 18/06/2014, 15:20

9 510 0
báo cáo hóa học:" HLA-A" doc

báo cáo hóa học:" HLA-A" doc

... kawaguch@sapmed.ac.jp; Toshihiko Torigoe - torigoe@sapmed.ac.jp; Akari Takahashi - atakahashi@sapporo.jst-plaza.jp; Masaki Murase - murasem@sapmed.ac.jp; Masanobu Kano - kanomasa@sapmed.ac.jp; Takuro ... Takuro Wada - twada@sapmed.ac.jp; Mitsunori Kaya - mkaya@sapmed.ac.jp; Satoshi Nagoya - nagoya@sapmed.ac.jp; Toshihiko Yamashita - tyamasit@sapmed.ac.jp; Noriyuki Sato - nsatou@sapmed.ac.j...

Ngày tải lên: 18/06/2014, 15:20

10 359 0
Báo cáo hóa học: " S110, a novel decitabine dinucleotide, increases fetal hemoglobin levels in baboons (P. anubis)" potx

Báo cáo hóa học: " S110, a novel decitabine dinucleotide, increases fetal hemoglobin levels in baboons (P. anubis)" potx

... set BG1 (TATGGTGGGAGAAGAAATTAGTAAAGG) and BG2 (AATAACCTTATCCTCCTCTATAAAATAACC) were used in the first round and BG2 and BG5 (GGTTGGTTAGTTTTGTTTTGATTAATAG) in the second round. Amplicons were cloned ... Lavelle 1,2* , Yogen Saunthararajah 1,3 , Kestis Vaitkus 1,2 , Mahipal Singh 1,2,5 , Virryan Banzon 1,2 , Pasit Phiasivongsva 4 , Sanjeev Redkar 4 , Sarath Kanekal 4 , David Bearss 4 , Chongtie...

Ngày tải lên: 18/06/2014, 16:20

8 443 0
Báo cáo hóa học: " Abstract Despite new additions to the standard of care therapy for high grade primary malignant brain tumors, the prognosis for patients with this disease is still poor." ppt

Báo cáo hóa học: " Abstract Despite new additions to the standard of care therapy for high grade primary malignant brain tumors, the prognosis for patients with this disease is still poor." ppt

... leukemia patients with residual disease on imatinib mesylate. Clin Cancer Res 2010, 16:338-47. 28. Moriai R, Asanuma K, Kobayashi D, Yajima T, Yagihashi A, Yamada M, Watanabe N: Quantitative analysis ... word anaplastic preceding the names, i.e., anaplastic astrocytomas (AA), anaplastic oligodendro- gliomas (AODG) or mixed anaplastic gliomas (MAG). The most malignant form, a WHO grade IV g...

Ngày tải lên: 18/06/2014, 16:20

10 589 0
báo cáo hóa học: " Testing a model of association between patient identified problems and responses to global measures of health in low back pain patients: a prospective study" pdf

báo cáo hóa học: " Testing a model of association between patient identified problems and responses to global measures of health in low back pain patients: a prospective study" pdf

... health. Global items based upon a broad amalgam of experiences e.g. Assessment of general health status or overall change in condition Usual activities (spanning a range of functional tasks) Patient-identified ... Journal of the American Medical Association 1995, 273:59-65. 5. Smith KW, Avis NE, Assmann SF: Distinguishing between quality of life and health status in quality...

Ngày tải lên: 18/06/2014, 19:20

11 590 0
báo cáo hóa học: " Associations between general self-efficacy and health-related quality of life among 12-13-year-old school children: a cross-sectional survey" potx

báo cáo hóa học: " Associations between general self-efficacy and health-related quality of life among 12-13-year-old school children: a cross-sectional survey" potx

... 30:186-193. 24. Bradley RH, Corwyn RF: Life satisfaction among European American, African American, Chinese American, Mexican American, and Dominican American adolescents. Int J Behav Dev 2004, 28:385-400. 25. ... study design, statis- tical analysis, interpretation of data and revision of the manuscript. RS contributed to statistical analysis, inter- pretation of data and revision of...

Ngày tải lên: 18/06/2014, 19:20

8 435 0
w