torkel franzen inexhaustibility a non exhaustive treatment 2004
...
Ngày tải lên: 12/06/2014, 16:12
... Publisher. All rights reserved Case Report Treatment of oroantral fistula with autologous bone graft and application of a non- reabsorbable membrane Adele Scattarella 1 , Andrea Ballini 1 , ... Roberto Grassi 1 , Andrea Carbonara 1 , Francesco Ciccolella 1 , Angela Dituri 1 , Gianna Maria Nardi 2 , Stefania Cantore 1 , Francesco Pettini 1 1. Department of Dental Sciences and Surg...
Ngày tải lên: 25/10/2012, 11:48
... of treatment and care because of longer survival. The estimated health gain from stroke service imple- mentation is substantial (about half a QALY), especially as compared to the total number of QALYs ... concerned all vascular events. We assume that the hazard ratio is equal for both cardiovascular event and other vascular events. Baeten et al. Cost Effectiveness and Resource Allocation...
Ngày tải lên: 25/10/2012, 10:35
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR
... Reference MF gacccgatgttcaagatact Saito et al., 2003b MR ctcctcccacaaatcaggac QMF agacgcacgctcacctcaa in this study QMR gagcagttcacgaaatcc QMT (Probe) atacgctcttactgtttccggccgcc BACT1369F cggtgaatacgttcycgg ... and TaqMan Probes used Primer and Probe Sequence (5’-3’) Reference MF gacccgatgttcaagatact Saito et al., 2003b MR ctcctcccacaaatcaggac QMF agacgcacgctcacctcaa in this study QMR gagcag...
Ngày tải lên: 05/09/2013, 10:15
Domestic Wastewater Reclamation Coupled with Biofuel/Biomass Production Based on Microalgae: A Novel Wastewater Treatment Process in the Future
... tank Flocculation and filtration Microalgae cultivation and reclamation Artificial wetland Disinfection Environmental and landscape reuse Municipal reuse Industrial reuse Carbon Capture and Storage ... demand for the proper treatment of the increasing amount of wastewater for water reuse, limitations exist in the present wastewater treatment and reclamation processes: Journal of...
Ngày tải lên: 05/09/2013, 10:17
A biodegradation and treatment of palm oil mill effluent (POME) using a hybrid up-flow anaerobic sludge bed (HUASB) reactor
... Environmental Engineering, University Tun Hussein Onn, Malaysia (UTHM). Abstract Generally, anaerobic treatment has become a viable alternative in support of industrial wastewater treatment. Particularly, ... a classical UASB and hybrid UASB-filter reactor. Water Science and Technology. 2004; 49(11):295–301. [3] Rajakumar R, Meenambal T. Comparative Study on Start – Up Perform...
Ngày tải lên: 05/09/2013, 16:11
Social factors as a basis for treatment
... housing cooperatives, (3) food cooperatives or (4) a consumer-oriented pharmacy (Warner 169 Social factors as a basis for treatment 11 Social factors as a basis for treatment Richard Warner Introduction Service ... I. and Test, M. A. (1980). Alternative to mental hospital treatment: I. Conceptual model, treatment program, and clinical evaluation. Archives of General Psychiatry,...
Ngày tải lên: 01/11/2013, 09:20
Tài liệu Diffie-Hellman Key Exchange – A Non-Mathematician’s Explanation docx
... “DH Math” box (trust me , the actual mathematical equation is a good deal longer and more complex; a simple example appears elsewhere in this article). By running the mathematical operation against ... Amateur Mathematician’s Explanation I am often asked for a better, though still simplified, explanation of exactly what happens in the “DH Math” portion of the diagram above. The best suc...
Ngày tải lên: 10/12/2013, 14:15
Use of an extension of the park's transformation to determine control laws applied to a non sinusoidal permanent magnet synchronous motor
Ngày tải lên: 03/01/2014, 19:50
Tài liệu Streetsmart Guide To Valuing A Stock (Mcgraw Hill-2004) (pdf) pptx
... an asset. The total stock market as measured by the S&P 500 Index has a beta of 1.0. The beta of a stock with the same price movement as the market also has a beta of 1.0. A stock that has ... crashed, managers of many corporations such as En- ron, WorldCom, and Adelphia have been indicted for fraud, and cer- tain Wall Street stock analysts have been discredited and have attained...
Ngày tải lên: 24/01/2014, 06:20