global and national macroeconometric modelling a long-run structural approach oct 2006

... Pesaran, Schuermann and Weiner (2004) adopts the structural cointegrating VAR approach to developing a model to analyse global financial and real inter- actions. As explained in Section 3.4 and ... economically meaningful. 17 Global and National Macroeconometric Modelling: A Long-Run Structural Approach Anthony Garratt Department of Economics, Birkbeck College, L...

Ngày tải lên: 11/06/2014, 05:36

... the daily return obtained at time τ . 11 Other studies such as Brennan et al. (1997), Campbell and Viceira (1999) and Jagannathan and Kocherlakota (1996) examine optimal portfolio choice as a function ... series that take repeated values over a certain range. The idea of spatial analysis is to calculate the frequency for each point on the spatial axis (right panel of Figure 1), that...

Ngày tải lên: 29/03/2014, 06:21

... Probabilistic Approaches to Natural Language - AAAI Technical -Report. American Association for Arti- ficial Intelligence, 1992. E. Brill and P. Resnik. A transformation based approach to ... classification, all words are initially classified as nouns. The naively annotated text is compared to the true annotation as indi- cated by a small manually annotated corpus, and tr...

Ngày tải lên: 31/03/2014, 06:20

... both database and result set metadata from the database server. This package has a set of classes and interfaces (such as DatabaseMetaData and ResultSetMetaData) that deal with database metadata, ... actual data, but you want to get metadata (data about data, such as the table names in a database). In JDBC metadata programming, we’re interested in database metadata and result set...

Ngày tải lên: 07/04/2014, 15:46

... regulations, and technical standards. • Prepare complete and clear reports and recommendations after appropriate analyses of relevant and reliable information. CONFIDENTIALITY Practitioners of management ... provincial societies in Canada. Ethics for Management Accountant Professionals Because of the pervasive nature of management accounting and the organizational level at which man...

Ngày tải lên: 18/12/2013, 09:13

... tangible and intangible benefits, and balanced scorecard. This study adopts a modified balanced scorecard method. The balanced scorecard is more useful than intel- lectual capital or a tangible and ... through confirmatory factor analysis (CFA) and structural equation analysis (SEA). 2. LITERATURE REVIEW Many researchers have emphasized three major factors for knowledge manageme...

Ngày tải lên: 24/01/2014, 00:20

... (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) containing a BamHI site. The gene was cloned at the NheI and BamHI sites ... S, Khachatr- yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A, Joachimiak A et al. (2001) Structure of Thermotoga maritima stationary phase survival protein SurE: a novel acid phosph...

Ngày tải lên: 18/02/2014, 14:20

... ¢-TCCGAAACCAGCG GCCGCTT TATCGCGTTA AAAC CGGT GATCAA ACCCC -3¢ and the reverse oligomer 5¢-GTAGGCCTT TGAATTCCTCAAAA AGTGCGGCTCGAT-3¢ were used to introduce a Not1 site followed by the hAd12pb ... gene was removed using the complementary oligomers 5¢-GGCGGGAGGGGCGATAATTTTATCGCGTTAAAA CCG-3¢ (forward) and 5¢-CGGTTTTAACGCGATAAAAT TATCGCCCCTCCCGCC-3¢ (reverse). Virus amplification was perform...

Ngày tải lên: 19/02/2014, 06:20