jhttransport phenomena and droplet formation during pulsed laser interaction with thin films

jhttransport phenomena and droplet formation during pulsed laser interaction with thin films

jhttransport phenomena and droplet formation during pulsed laser interaction with thin films

... 47907 Transport Phenomena and Droplet Formation During Pulsed Laser Interaction With Thin Films This work investigates transport phenomena and mechanisms of droplet formation during a pulsed laser interaction ... study the transport phenomena and droplet formation in a pulsed laser thin film interaction. Little work has been done on analyzin...

Ngày tải lên: 06/05/2014, 08:55

8 228 0
transport phenomena and droplet

transport phenomena and droplet

... 47907 Transport Phenomena and Droplet Formation During Pulsed Laser Interaction With Thin Films This work investigates transport phenomena and mechanisms of droplet formation during a pulsed laser interaction ... study the transport phenomena and droplet formation in a pulsed laser thin film interaction. Little work has been done on analyzin...

Ngày tải lên: 06/05/2014, 09:02

8 270 0
Báo cáo khoa học: Ion-binding properties of Calnuc, Ca2+ versus Mg2+ – Calnuc adopts additional and unusual Ca2+-binding sites upon interaction with G-protein pdf

Báo cáo khoa học: Ion-binding properties of Calnuc, Ca2+ versus Mg2+ – Calnuc adopts additional and unusual Ca2+-binding sites upon interaction with G-protein pdf

... yielding the b-band and the c-band, respectively; with parvalbumin, however, the J-band is retained at all stoichiometries. Also, whereas the J-band is replaced by the b-band and the c-band upon the ... and d-crystallin behave similarly (show only one band), whereas calmodulin and troponin behave like each other. On the other hand, Calnuc and parvalbumin generate both the J-band...

Ngày tải lên: 07/03/2014, 00:20

18 333 0
Báo cáo khoa học: The enzymatic activity of SR protein kinases 1 and 1a is negatively affected by interaction with scaffold attachment factors B1 and 2 pot

Báo cáo khoa học: The enzymatic activity of SR protein kinases 1 and 1a is negatively affected by interaction with scaffold attachment factors B1 and 2 pot

... 1 and 1a is negatively affected by interaction with scaffold attachment factors B1 and 2 Dora Tsianou 1 , Eleni Nikolakaki 2 , Alexandra Tzitzira 1 , Sofia Bonanou 1 , Thomas Giannakouros 2 and Eleni ... BamHI site and reverse: 5¢-TT GAATTCTCAGTAGCGGCGAGT GAA-3¢, containing the underlined EcoRI site. The PCR fragment was digested with BamHI and EcoRI, repurified and subcloned...

Ngày tải lên: 30/03/2014, 01:20

16 573 0
Experimental and numerical investigation of heat transferand phase change phenomena during excimer laser interactionwith nickel

Experimental and numerical investigation of heat transferand phase change phenomena during excimer laser interactionwith nickel

... heat transfer and phase change phenomena during excimer laser interaction with nickel specimens[ Based on time!resolved measurements in the laser ~uence range between 1[4 J cm −1 and 09[4 J cm −1 \itis found ... ~uence region with laser ~uences between 4[1 and 8[9 J cm −1 \ and the high ~uence region with laser ~uences above 8[9 Jcm −1 [ Figure 2 shows variations o...

Ngày tải lên: 06/05/2014, 08:55

12 332 0
measurement of solid liquid interface temperature during pulsed excimer laser melting of polycrystalline silicon films

measurement of solid liquid interface temperature during pulsed excimer laser melting of polycrystalline silicon films

... is heated by a pulsed KrF excimer laser with a pulse duration of 26 ns and a wavelength of 248 nm ͑Fig. 1͒. A beam homogenizer is used to ensure spatial uniformity in the laser beam. The laser intensity ... diode is recorded on a digitizing oscilloscope with a 1 GHz sampling rate. Bandpass filters with center wavelengths at 1.2, 1.4, 1.5, and 1.6 ␮ m and bandwidths of appro...

Ngày tải lên: 06/05/2014, 08:54

3 170 0
planar laser imaging and modeling of matrix assisted pulsed laser

planar laser imaging and modeling of matrix assisted pulsed laser

... of 12, 25, and 50 ␮ m and for two laser- beam diameters of 30 and 60 ␮ m. The laser FIG. 10. Correlation for maximum bubble radius with respect to beam di- ameter, ink thickness, and laser energy. ... obtained during this investigation were analyzed and compared based on the primary process parameters of laser energy, beam diameter, and ink-film thickness. To en- hance o...

Ngày tải lên: 06/05/2014, 09:01

8 252 0
 Báo cáo y học: " Efficacy of the Valsalva Maneuver on Needle Projection Pain and Hemodynamic Responses During Spinal Puncture"

Báo cáo y học: " Efficacy of the Valsalva Maneuver on Needle Projection Pain and Hemodynamic Responses During Spinal Puncture"

... rated as mild, 4–6 as moderate, and > 6 as severe. Blood pressure and heart rate, five minutes before the procedure, during the spinal puncture and first and third minutes after that, were ... pain and 3= severe pain, and visual analog scale of 0–10, where 0=no pain and 10= worst imaginable pain. Agrawal et al used both, 4-point scale and VAS, in which the first sca...

Ngày tải lên: 25/10/2012, 11:15

5 514 0
Trend of domestic and international market during period 2003-2006

Trend of domestic and international market during period 2003-2006

... proportions of domestic and internal markets during the period studied Chart 2: Average proportions of domestic and international market during the period 2003 – 2006 Following with the trend above, ... us some general information Name: Legal form: Address: Telephone: Tele fax: e -mail of contact person: And indicate the names of the persons to contact and their function within...

Ngày tải lên: 19/07/2013, 09:49

33 232 0
A CFD analysis of transport phenomena and electrochemical reactions in a tubular-shaped PEM fuel cell

A CFD analysis of transport phenomena and electrochemical reactions in a tubular-shaped PEM fuel cell

... and simulation for heat and mass transport in PEM fuel cells are being used extensively in researches and industrial applications to gain better understanding of the fundamental processes and ... accounts for the major transport phenomena such as convective and diffusive heat and mass transfer, electrode kinetics, transport and phase-change mechanism of water, and potenti...

Ngày tải lên: 05/09/2013, 14:58

26 609 0
Từ khóa:
w