applications of chimeric genes and hybrid proteins, part a

applications of chimeric genes and hybrid proteins, part a

applications of chimeric genes and hybrid proteins, part a

... type MuA derivative ~ AplacMu50 a immA IacZYA ' Transcriptional AplacMu52" AplacMu51 d imm21 lacZYA ' Transcriptional AplacMu54 ~" AplacMu53 d immA, Kan R lacZYA ' ... necessary for translational initiation and contain functional copies of both lacZ and lacy genes, but are truncated in lacA (and are lacA ). Fusions designated lac'ZYA&...

Ngày tải lên: 10/04/2014, 11:02

614 282 0
applications of chimeric genes and hybrid proteins, part b

applications of chimeric genes and hybrid proteins, part b

... I His-tag CTC ATC TCA GAA GAT GAG CTG A& amp;T AGC GCC GTC GACrCAT CAT CAT CAT CAT LISEEDLNSAVDHHHHH Pmel* C&i-& GTTTAAACCC H stop FIG. 2. Additional vectors to make AP fusion ... APtag-2,6 and APtag-4 (not pre- viously published) vectors are diagrammed. APtag-2 and -4 are for transient transfection, whereas APtag-1 is for stable transfection. APtag-2 and -4 have a...

Ngày tải lên: 10/04/2014, 11:02

696 394 0
Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx

Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx

... connected with the facts that modification of particular sites in the genome of living cells is naturally stochastic on the one hand, and influenced by the actual structural and functional state of the given ... Ichimiya S, Nakagawara A, Sakuma Y, Kimura S, Ikeda T, Satoh M, Takahashi N, Sato N & Mori M (2000) p73: structure and function. Pathol Int 50, 589–593. 23 Levrero M, D...

Ngày tải lên: 19/02/2014, 05:20

14 598 0
Tài liệu Báo cáo khoa học: "Applications of GPC Rules and Character Structures in Games for Learning Chinese Characters" doc

Tài liệu Báo cáo khoa học: "Applications of GPC Rules and Character Structures in Games for Learning Chinese Characters" doc

... linguistics-based approaches. Pictogram is a major formation of Chinese characters, and radicals carry partial semantic information about Chinese charac- ters. Hence, one may use radicals as hints to ... University, Taiwan ‡↑↕ Academia Sinica, Taiwan † chaolin@nccu.edu.tw, ‡ chiaying@gate.sinica.edu.tw Abstract We demonstrate applications of psycholin- guistic and sublexic...

Ngày tải lên: 19/02/2014, 19:20

6 590 0
Báo cáo khoa học: Differential expression of liver and kidney proteins in a mouse model for primary hyperoxaluria type I pdf

Báo cáo khoa học: Differential expression of liver and kidney proteins in a mouse model for primary hyperoxaluria type I pdf

... and fatty acid pathways. Abbreviations AGT1, alanine-glyoxylate aminotransferase 1; AGT2, alanine-glyoxylate aminotransferase 2; AGXT, alanine-glyoxylate aminotransferase gene; Agxt ) ⁄ ) , alanine-glyoxylate ... renal excretion of oxalate causes calcium oxalate deposition (nephrocalcinosis and urolithiasis) and eventual loss of renal function. After renal failure, calcium oxalate d...

Ngày tải lên: 23/03/2014, 03:20

9 482 0
A CFD analysis of transport phenomena and electrochemical reactions in a tubular-shaped PEM fuel cell

A CFD analysis of transport phenomena and electrochemical reactions in a tubular-shaped PEM fuel cell

... land areas a noticeable decrease takes place. It can be seen that for a planar shape, a high fraction of the current is generated at the catalyst layer that lies beneath the air inlet area, ... evaluate the performance of a planar and a tubular-shaped PEM fuel cell. 2.1. Computational domain The full computational domains for the planar and tubular-shaped PEM fuel cel...

Ngày tải lên: 05/09/2013, 14:58

26 609 0
An experimental investigation of heat transfer and fluid flow in a rectangular duct with inclined discrete ribs

An experimental investigation of heat transfer and fluid flow in a rectangular duct with inclined discrete ribs

... Performance of Solar air heater Proceedings of XVII National and VI ISHME/ASME Heat and Mass Transfer Conference, IGCAR, Kalpakkam India 2004; Jan. 05-07. [2] Han J. C. “Heat transfer and friction ... 997 [21] Aharwal K.R. Gandhi B.K. and Saini J.S. “Investigation of heat transfer and friction using inclined discrete ribs on absorber plate of a solar air heater” 19th...

Ngày tải lên: 05/09/2013, 16:10

12 831 0
Knut Einar Rosendahl (ed.) Social Costs of Air Pollution and Fossil Fuel Use – A Macroeconomic Approach pdf

Knut Einar Rosendahl (ed.) Social Costs of Air Pollution and Fossil Fuel Use – A Macroeconomic Approach pdf

... and measuring sites. Based on geographical data on crop areas and yields, total loss of wheat, potato and meadow is calculated. As the agricultural sector is very regulated in Norway, the shadow ... Haagenrud and Skancke, deals with corrosion costs of building materials and cars due to air pollution. Based on Norwegian data on air pollution, material stocks and maintenance pri...

Ngày tải lên: 06/03/2014, 16:20

147 425 0
Báo cáo Y học: Fusion of farnesyldiphosphate synthase and epi-aristolochene synthase, a sesquiterpene cyclase involved in capsidiol biosynthesis in Nicotiana tabacum docx

Báo cáo Y học: Fusion of farnesyldiphosphate synthase and epi-aristolochene synthase, a sesquiterpene cyclase involved in capsidiol biosynthesis in Nicotiana tabacum docx

... C-terminal P6 5¢-AT GGATCCGGAATGAGTAGTACCGATCTG-3¢ FPPS N-terminal P7 5¢-TA GGATCCAATTTTGATGGAGTCCAC-3 eAS C-terminal P8 5¢-AT GGATCCGGAATGGCCTCAGCAGCAGTT-3¢ eAS N-terminal 3572 M. Brodelius et al. ... 5¢-CTA CTCGAGCTACTTTTGCCTCTTGTA-3 FPPS C-terminal P3 5¢-TAGAG CCATGGCCTCAGCAGCAGTT¢-3¢ eAS N-terminal P4 5¢-CTACTCGAGTCAAATTTTGATGGAGTC-3¢ eAS C-terminal P5 5¢-TA GGATCCCTTTTGCCTCTTGTAAAT-3¢ .....

Ngày tải lên: 24/03/2014, 03:21

8 410 0
modeling of chemical kinetics and reactor design by a. kayode coker

modeling of chemical kinetics and reactor design by a. kayode coker

... raw material source for ammonia plants is natural gas for producing hydrogen by steam reforming. An alternative raw material is naphtha, which also requires partial oxidation. Hydrogen streams from ... day (6 Mscfd) of natural gas at a temperature of 16°C and a pressure of 23.4 barg. Table 4 shows its composition. Natural gas is desulfurized because sulfur has an adverse effect on...

Ngày tải lên: 01/04/2014, 10:25

1,1K 7,5K 0
w