molecular biology of the parathyroid - tally naveh-many

molecular biology of the parathyroid - tally naveh-many

molecular biology of the parathyroid - tally naveh-many

... and the rat (distal element) sequence are shown in bold. MOLECULAR BIOLOGY INTELLIGENCE UNIT Tally Naveh-Many Molecular Biology of the Parathyroid Molecular Biology of the Parathyroid NAVEH-MANY MBIU MOLECULAR ... 3'-UTRs (Table 1). In general the difference in size in Molecular Biology of the Parathyroid 12 the PTH mRNA of the differe...

Ngày tải lên: 08/04/2014, 12:52

213 336 0
EVOLUTION OF THE MOLECULAR BIOLOGY OF BRAIN TUMORS AND THE THERAPEUTIC IMPLICATIONS pdf

EVOLUTION OF THE MOLECULAR BIOLOGY OF BRAIN TUMORS AND THE THERAPEUTIC IMPLICATIONS pdf

... β1. A number of proteinase families are capable of generating the proteolytic fragments of versi‐ can. Matrix metalloproteinase (MMP )-1 , -2 , -3 , -7 , and -9 , ADAMTS-1, -4 , -5 and -9 cleave versican ... malignan‐ Evolution of the Molecular Biology of Brain Tumors and the Therapeutic Implications10 cies. Elevated versican production occurs in eit...

Ngày tải lên: 23/03/2014, 10:20

648 575 1
Molecular Biology of Secondary Metabolism - Case Study for Glycyrrhiza Plants

Molecular Biology of Secondary Metabolism - Case Study for Glycyrrhiza Plants

... transgenic N. tabacum plants expressing the coding region of the chpA gene of Thermosyne- chococcus elongatus BP-1 in the cytosol under the control of the CaMV 35S pro- moter. The transgenic tobacco plants ... for the transgenic plants expressing the Synechococcus fructose- 1, 6-/ sedoheptulose-1,7-bisphosphatase (FBP/SBPase) in order to increase the level of Ribul...

Ngày tải lên: 25/10/2013, 05:20

33 614 1
Tài liệu Báo cáo Y học: Molecular modeling of the dimeric structure of human lipoprotein lipase and functional studies of the carboxyl-terminal domain docx

Tài liệu Báo cáo Y học: Molecular modeling of the dimeric structure of human lipoprotein lipase and functional studies of the carboxyl-terminal domain docx

... meager. In the head-to-tail orientation, the catalytic site in the N-terminal domain of one subunit and the substrate recognition site in the C-terminal domain of the other face each other, thereby ... shape of the dimeric structure and the key heparin-binding residues in the N-terminal domain held coordinately by the two subunits on the top of the hollow (Fig....

Ngày tải lên: 21/02/2014, 15:20

10 680 0
Báo cáo khoa học: Molecular mechanisms of the phospho-dependent prolyl cis ⁄ trans isomerase Pin1 docx

Báo cáo khoa học: Molecular mechanisms of the phospho-dependent prolyl cis ⁄ trans isomerase Pin1 docx

... conformation of the Glu-Pro dipeptide in the hinge region between the last b-strand and the core of CKS. The crystal structure of the com- plex of CKS with CDK2 ⁄ cyclin A clearly showed that only the monomeric, ... revealed the existence of the trans conformation of the Ser-Pro bond in the peptide sub- strate. Similarly, the major proline-directed phospha-...

Ngày tải lên: 07/03/2014, 05:20

12 477 0
Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc

Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc

... 5¢-CG GGATCCCAATCTGTTGCTAA TTAGG-3¢)andthe3¢ specific oligonucleotides (5¢-GA AGATCTACCACACCTCCTCATCTCC-3¢) for ampli- fication of the region from )180 to )36 and (5¢-GA AGAT CTAACTAGATTTTACCATTGG-3¢) for amplification of the region ... particular, calcium- containing-mineral such as hydroxyapatite [2]. Although the exact m ode of action of MGP at the molecular level is current...

Ngày tải lên: 08/03/2014, 10:20

10 475 0
Báo cáo khoa học: Molecular basis of the unusual catalytic preference for GDP/GTP in Entamoeba histolytica 3-phosphoglycerate kinase doc

Báo cáo khoa học: Molecular basis of the unusual catalytic preference for GDP/GTP in Entamoeba histolytica 3-phosphoglycerate kinase doc

... from the V m ⁄ [V m ⁄ K m ] ratio [21], then the specific nucleotide-binding constant (K d ) was deter- mined in the absence of 3-phosphoglycerate for each nucleotide in the wild-type and the double-mutant enzymes ... affinity. Hence, the double mutant yielded a very strong non- additive increment of its catalytic efficiency of 9.2 times for the phosphorylation of the ade...

Ngày tải lên: 16/03/2014, 01:20

11 449 0
Báo cáo khoa học: Molecular dynamics of the DNA-binding domain of the papillomavirus E2 transcriptional regulator uncover differential properties for DNA target accommodation pdf

Báo cáo khoa học: Molecular dynamics of the DNA-binding domain of the papillomavirus E2 transcriptional regulator uncover differential properties for DNA target accommodation pdf

... that defines the surface of the gap region [26]. In the interior of the HPV-16 b-barrel, at the inter- face of each dimer, only one small cavity, present for a short percentage of the simulation ... S 2 . The order parameter S 2 [23–25] was calculated from MD simula- tion for the NH atoms of the E2 chains of both HPV- 16 and BPV-1 (Fig. 4A,B), and in the case o...

Ngày tải lên: 16/03/2014, 10:20

11 398 0
Reproductive Biology of the Laboratory Mouse docx

Reproductive Biology of the Laboratory Mouse docx

... Flexibilitytodevelopcustomizedapproaches JAX®Mice&Serv ices jaxservices@jax.org • 1-8 0 0-4 2 2-6 423 • 1-2 0 7-2 8 8-5 845 • www.jax.org/jaxmice Overview Reproductive Biology of the Mouse • Reproductivecharacteristics • Determining ... g) Reproductive Biology of the Reproductive  Biology  of  the  LaboratoryMouse Jim Yeadon, PhD Jim  Yeadon,  PhD T...

Ngày tải lên: 22/03/2014, 12:20

43 292 1
Từ khóa:
w