... Cellular Pathology. Edited by John Crocker and Paul G. Murray 2003 John Wiley & Sons, Ltd ISBN: 0-4 7 0-8 447 5-2 Molecular Biology in Cellular Pathology Molecular Biology in Cellular Pathology. ... B15 2TT, UK Sara Dyer Regional Genetics Service, Birmingham Women’s Hospital, Edgbaston, Birmingham B15 2TG, UK David J. Harrison Department of Pathol...
Ngày tải lên: 08/04/2014, 12:51
... trimeric GTP-binding proteins (G- proteins). The enzyme-linked receptors include the receptor guanylyl cyclases, receptor tyrosine kinases, tyrosine-kinase-associated receptors, receptor tyrosine phosphatases ... I Molecular Targets Molecular Biology in Medicinal Chemistry. Edited by Th. Dingermann, D. Steinhilber, G. Folkers Copyright 8 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Wei...
Ngày tải lên: 08/04/2014, 12:51
current topics in computational molecular biology - tao jiang , ying xu , michael q. zhang
... 279–284. Golub, T. R ., Slonim, D. K ., Tamayo, P ., Huard, C ., Gaasenbeek, M ., Mesirov, J. P ., Coller, H ., Loh, M. L ., Downing, J. R ., Caligiuri, M. A ., Bloomfield, C. D ., and Lander, E. S. (1999). Molecular ... Chao Tang, Ronald Taylor, John Tromp, Ilya A. Vakser, Martin Vingron, Natascha Vukasinovic, Mike Waterman, Liping Wei, Dong Xu, Zhenyu xii...
Ngày tải lên: 08/04/2014, 12:45
basic cell culture protocols methods in molecular biology - cheryl d. helgason, cindy l. miller
... (Myco-5'): cgc ctg agt agt acg twc gc tgc ctg rgt agt aca ttc gc cgc ctg agt agt atg ctc gc cgc ctg ggt agt aca ttc gc 3' primers (Myco-3'): gcg gtg tgt aca ara ccc ga gcg gtg tgt ... Oxford. 4. Bonifacino, J. S ., Dasso, M ., Harford, J. B ., Lippincott-Schwartz, J ., and Yamada, K. M. (eds.) (2000) Current Protocols in Cell Biology, Wiley, New York. 01/Helgason...
Ngày tải lên: 08/04/2014, 12:50
cell cycle control mechanisms and protocols methods in molecular biology - tim humphrey, gavin brooks
... transcription in fission yeast. Curr. Biol. 1 2, 1100–1105. 23. Espinoza, F. H ., Farrell, A ., Erdjument-Bromage, H ., Tempst, P ., and Morgan, D. O. (1996) A cyclin-dependent kinase-activating kinase (CAK) in ... Saccharomyces cerevisiae, in Molecular and Cellular Biology of the Yeast Saccharomyces (Pringle, J. R ., Roach, J. R ., and Jones, E. W ., eds....
Ngày tải lên: 08/04/2014, 12:50
data analysis in molecular biology and evolution - xuhua xia
... 15 ACGCTTAAAACTCTAAGGACTTGGCGGTGCCCTAAACCCACCTAGAGGAGCCTGTTCTATAA TCGATAACCCACGATACACCCGACCATCTCTTGCCCCAGCCTACATACCGCCGTCCCCAGCC CGCCTATGAGAGACAGCAAGCATAATAGCTCGCTAGCAAGACAGGTCAAGGTATAGCATATG AGATGGAAGAAATGGGCTACATTTTCTAGTCTAGAACAACGAAAGAGGGCATGAAACCCCTC CGAAGGCGGATTTAGCAGTAAAGTGGGATCAGAAAGCCCACTTTAAGCCGGCCCTAGGGC 4.3.2 Generating PHYLTEST ... 370 #emu_{emu} GCTTAGCCCTAAATCTTGATACTCACCTTACCAG...
Ngày tải lên: 08/04/2014, 12:50
molecular methods in developmental biology
... cps, Sigma [St. Louis, MO] M-0387). 9. Lipofectamine™ (Gibco BRL 1832 4-0 12). 10. Rhodamin-dextran (1 0,0 00 MW, e .g ., Molecular Probes, [Eugene, OR] D-1816). 11. Biotin-dextran (1 0,0 00 MW, lysine ... Blessing, M ., Winnier, G. E ., Suzuki, N ., and Jones, C. M. (1994) Growth factors in development: the role of TGF-beta related polypeptide signal- ling molecules...
Ngày tải lên: 11/04/2014, 09:52
Molecular Biology of Secondary Metabolism - Case Study for Glycyrrhiza Plants
... 44: 447–450. Palenik, B ., Ren, Q ., Dupont, C.L ., Myers, G. S ., Heidelberg, J.F ., Badger, J.H ., Madupu, R ., Nelson, W.C ., Brinkac, L.M ., Dodson, R.J ., Durkin, A.S ., Daugherty, S.C ., Sullivan, S.A ., Khouri, H ., Mohamoud, ... Suruga, K ., Ogawa, M ., Satoh, T ., Kadokura, K ., Yamada, S ., Hakamata, W ., Isobe, K ., It...
Ngày tải lên: 25/10/2013, 05:20
Tài liệu OXFORD DICTIONARY OF Biochemistry and Molecular Biology REVISED EDITION Managing Editor Professor pdf
... is b, b , b -, b -, -b, - b , B, B , B -, B -, -B, - B 1.6 Subscripts and superscripts Single letters with subscripts or superscripts are treated as single letters for the purposes of indexing, ... 1863 amino acids. The protein includes a RING finger motif in the N-terminal region and two domains in the C-terminal region that are involved in DNA bindi...
Ngày tải lên: 23/01/2014, 07:20