0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "LIMITS OF A SENTENCE BASED PROCEDURAL APPROACH FOR ASPECT CHOICE IN GERMAN-RUSSIAN MT" potx

Báo cáo khoa học:

Báo cáo khoa học: "LIMITS OF A SENTENCE BASED PROCEDURAL APPROACH FOR ASPECT CHOICE IN GERMAN-RUSSIAN MT" potx

... LIMITS OF A SENTENCE BASED PROCEDURAL APPROACH FOR ASPECT CHOICE IN GERMAN-RUSSIAN MT Bianka BUSCHBECK, Renat¢ HENSCHEL, Iris H6SER, Gerda KLIMONOW, Andreas K(ISTNER, Ingrid STARKE Zentralinstitut ... and aspect. Since the formal category of aspect is missing in German the information required for generating Rus- sian aspect forms has to be extracted from different representation levels. A ... VIRTEX FOR DETERMINING ASPECT AND TENSE The MT system VIRTEX is made to translate simple German main clauses into Russian including the decision of appropriate aspect forms for simple and complex...
  • 6
  • 504
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "DESIGN OF A KNOWLEDGE-BASED REPORT GENERATOR" doc

... lexicon, clausal grammatical categories, and a clause-combining grammar, provide an appropriate level of knowledge representation for gen- erating that type of text which may be categorized as periodic ... coordinate -sentence, subordinate -sentence, subordinate-participial-clause, prepositional-phrase, and others. Semantic analysis of a sample of natural text stock reports discloses that a hierarchy ... element format. For example, the fact that indicates the closing status of the Dow Jones Average of 30 Industrials for January 12, 1983 is: (make fact "fname CLb-~rAT "iname DJI...
  • 6
  • 452
  • 0
Báo cáo khoa học: Development of a baculovirus-based fluorescence resonance energy transfer assay for measuring protein–protein interaction potx

Báo cáo khoa học: Development of a baculovirus-based fluorescence resonance energy transfer assay for measuring protein–protein interaction potx

... (5¢-CCTGTCAGATCTCCGCCATGGCTAACAATGCATCTCT-3¢), and a BamHI site(bold) was introduced into the reverse primer (5¢-TCTCCCGGATCCAAAGAGAAATACCCATA-TA-3¢) to facili-tate vector–insert ligation. Amplification ... methods. Addition-ally, the same insect cell line can be used routinely for expressing any recombinant proteins of interest, allowingvarious combinations of molecules to be tested in a rapidfashion ... School of Biological Sciences, The Australian National University,Canberra, Australia A new baculovirus -based fluorescence resonance energytransfer (Bv-FRET) assay for measuring multimerization of cell...
  • 9
  • 380
  • 0
Báo cáo khoa học: Suppression of heat- and polyglutamine-induced cytotoxicity by nonsteroidal anti-inflammatory drugs potx

Báo cáo khoa học: Suppression of heat- and polyglutamine-induced cytotoxicity by nonsteroidal anti-inflammatory drugs potx

... proteins; indomethacin; nonsteroidalanti -in ammatory drugs; nordihydroguaiaretic acid; poly-glutamine d isease.Nonsteroidal anti -in ammatory drugs (NSAIDs) such assodium salicylate (SA) and indomethacin ... of heat- and polyglutamine-induced cytotoxicityby nonsteroidal anti -in ammatory drugsKeiichi Ishihara, Nobuyuki Yamagishi and Takumi HatayamaDepartment of Biochemistry, Kyoto Pharmaceutical ... Pharmaceutical University, 5 Nakauchi-cho, Misasagi,Yamashina-ku, Kyoto 607–8414, Japan. Fax: +81 75 595 4758,Tel.: +81 75 595 4653, E-mail: hatayama@mb.kyoto-phu.ac.jpAbbreviations: AA, arachidonate;...
  • 7
  • 311
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Improvement of a Whole Sentence Maximum Entropy Language Model Using Grammatical Features" potx

... Polit´ecnica de ValenciaCamino de vera s/n, 46022-Valencia (Spain)famaya, jbenedi @dsic.upv.esAbstract In this paper, we propose addinglong-term grammatical information in a Whole Sentence Maximun ... is easy to sample from it in the traditional way.3 The grammatical featuresThe main goal of this paper is the incorporation of gramatical features to the WSME. Grammaticalinformation may be ... from a training sample. Each word in thetraining sample has a part -of- speech tag (POStag)associated to it. These POStags are considered asword categories and are the terminal symbols of our...
  • 8
  • 332
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Impact of computerized physician order entry on medication prescription errors in the intensive care unit: a controlled cross-sectional trial"

... medical and nursing fileand the laboratory data. Renal function was noted for everypatient and renal failure was defined as calculated creatinineclearance less than 50 ml/minute. The parameters ... physicians had to order a 'vancomycin loading dose' and a 'vancomycin dose accord-ing to plasma level', without having to adjust anything, whichvirtually eliminates the risk of ... statistical analysis and drafting of the manuscript.BC was responsible for data acquisition, analysis of the data,and drafting of the manuscript. JD was responsible for con-ceiving the study, statistical...
  • 9
  • 738
  • 1
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

... substantianigra pars compacta and appearance of Lewy bodiesconsisting of aggregated protein, mainly a- synuclein, in Keywordsamyloid; fibrillation; Parkinson’s disease;synuclein; thioflavin TCorrespondenceI. ... H, Okamura K, Bauer PO, Furukawa Y, ShimizuH, Kurosawa M, Machida Y, Miyazaki H, Mitsui K,Kuroiwa Y et al. (2008) RNA-binding protein TLS is a major nuclear aggregate-interacting protein in hunting-tin ... dopamine as theneurotransmitter. Thus, reduction of dopamine levels in the striatum is a hallmark of Parkinson’s disease. A variety of pesticides including paraquat, rotenoneand dielderin have...
  • 11
  • 754
  • 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

... GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGCcyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTGcyc1-z GCATCAGAAAGCATAGGCcyc1-m TGGGAATACGATAGAGTAGnb2 primer GTTTAAACGAGCTCGAATTCCoq7 in fission yeast R. ... GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTGSpcoq3-y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTGSpcoq3-z GTATGCGATGTGGAATTTGSpcoq3-m GATGCCTTCCAATGAATTACcyc1-w GAACCAATGAAATAAGGGCGcyc1-x GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGCcyc1-y ... GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATCSpcoq7-y GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATGSpcoq7-z CAGGCAAGTCTGTTTATTGSpcoq7-m CTTGGATGAGCTTTCCACSpcoq3-w CGTATAAATTACAATACCGSpcoq3-x GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTGSpcoq3-y...
  • 16
  • 646
  • 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... 5¢-CTCGAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA-1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former,and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCAGGGG-3¢ for the latter. The ... lymphaticendothelial cells of the mouseTakashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura,Nobuaki Yoshida and Hirotake IchiseLaboratory of Gene Expression and Regulation, ... S, Lostaglio S, De CalmanoviciRW, Martin-Padura I, Breviario F, Garlanda C,Ramponi S, Mantovani A & Vecchi A (1997) A generalstrategy for isolation of endothelial cells from murinetissues....
  • 11
  • 873
  • 0
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf

Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf

... 4753Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalaminand intrinsic factorSergey N. Fedosov1, Charles ... Haber E & Olesen H (1971) Nature of vitaminB12binding. II. Steric orientation of vitamin B12onbinding and number of combining sites of human intrin-sic factor and the transcobalamins. ... Clinical Biochemistry, AS Aarhus University Hospital, DenmarkCobalamin (Cbl, vitamin B12) is a cofactor for twocrucial enzymes in mammals [1]. Therefore, anenhanced in ux of the vitamin...
  • 12
  • 603
  • 0

Xem thêm

Từ khóa: tuyên tập cac bao cao khoa học hội nghị khoa học địa i apos abáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam