Báo cáo Y học: Characterization of heparin binding by a peptide from amyloid P component using capillary electrophoresis, surface plasmon resonance and isothermal titration calorimetry ppt
... Characterization of heparin binding by a peptide from amyloid P component using capillary electrophoresis, surface plasmon resonance and isothermal titration calorimetry Maria J. Hernaiz 1 , ... heparin binding capabilities. Keywords: amyloid P component; heparin binding; surface plasmon resonance; capillary electrophoresis; isothe...
Ngày tải lên: 31/03/2014, 23:20
... complementation with a wild-type HbpR expressed from another plasmid in the same cell (pHYBP124, Fig. 5D). The combinations pHYBP124, pHB164 (wild-type HbpR plus CBP–HbpR) and pHYBP124, pHYBP103 ... M (2004) ATP-dependent transcriptional activation by bac- terial PspF AAA+ protein. J Mol Biol 338, 863–875. 19 Tropel D & van der Meer JR (2002) Identification and physical characte...
Ngày tải lên: 07/03/2014, 17:20
... plasma and in PBS after addition of glutaraldehyde. Pravastatin assay by UPLC A reversed phase UPLC method was developed and used throughout the study for pravastatin assay. The mobile phase ... Research Paper Characterization of Human Erythrocytes as Potential Carrier for Pravas- tatin: An In Vitro Study Gamal El-din I. Harisa, Mohamed F. Ibrahim, Fars K. Alanazi Dep...
Ngày tải lên: 25/10/2012, 11:10
Báo cáo y học: "Characterization of erythrovirus B19 genomes isolated in liver tissues from patients with fulminant hepatitis and biliary atresia who underwent liver transplantation"
... Naoto Aiba 6 and Tetsutaro Sata 1 1. Department of Pathology, National Institute of Infectious Diseases, Tokyo, Japan 2. Department of Transplantation Surgery, Nagoya University Hospital, ... factors such as posthepatitic aplasia, B19, and drugs. Langnas et al. [1] reported the possibility of B19 as the cause of non -A- C fulminant hepatitis-associated aplastic anemia....
Ngày tải lên: 26/10/2012, 10:03
Báo cáo y học: "Characterization of N200 and P300: Selected Studies of the Event-Related Potential Salil H. Patel 1 and Pierre N. Azzam 2"
... via auditory passive single-tone and passive oddball paradigms may similarly be effective when active responses are infeasible [63]. Further, P3 00 parameters may be affected by familiarization ... of cortical potential imaging methods to model responses to auditory stimuli supports the hypothesis of temporal- and spatial distinction of the Novelty P3 and parietal P3...
Ngày tải lên: 02/11/2012, 11:08
Tài liệu Báo cáo Y học: Characterization of an omega-class glutathione S-transferase from Schistosoma mansoni with glutaredoxin-like dehydroascorbate reductase and thiol transferase activities pptx
... (GeneBank accession num- ber AI975843). A 549-bp fragment was amplified by PCR using oligonucleotides GSTX1: 5¢- GTTGTCGACAAA CATCTCAACTAG-3 and GSTX3: 5¢-GTAAGTGTGG GAATAAGATCAAATC from adult S. mansoni ... (TGGAACTT ATCGTCAACTTTTCCATCC-3¢)forS. mansoni a- tubu- lin. SmGSTO amplification bands were quantified by using GelPro and normalized by comparing to a- tubulin ampli- fi...
Ngày tải lên: 21/02/2014, 01:21
Tài liệu Báo cáo Y học: Characterization of a cloned subtilisin-like serine proteinase from a psychrotrophic Vibrio species doc
... Invitrogen was used for expression. The gene was amplified with PCR from genomic Vibrio DNA using the primers 5¢-ATGTTAAA GAAAGTATTAAGTTGTTG-TATTGCAGC-3¢ and 5¢-AAAGTTTGCTTGGAGCGTCAAGCC-ACTGTAAG CCG-3¢, ... succinyl-AlaAlaProPhe -p- nitroanilide (Suc- AAPF-NH-Np), guanidinium thiocyanate (GdmSCN), and chemicals used for preparation of buffers were from the Sigma Chemical Company (S...
Ngày tải lên: 21/02/2014, 01:21
Tài liệu Báo cáo Y học: Characterization of a novel silkworm (Bombyx mori ) phenol UDP-glucosyltransferase potx
... ith a specific enz yme activity. Keywords: Bombyx mori; detoxication; insect; UDP- glycosyltransferase. The UDP-glycosyltransferases ( UGTs) are a superfamily of enzymes that p lay a central role ... Technology and Medicine, London SW7 2AZ, UK; 2 Laboratory of Molecular Entomology and Baculovirology, Riken, Wako, Japan Sugar conjugation is a major pathway for the inactivation...
Ngày tải lên: 22/02/2014, 04:20
Báo cáo khoa học: Characterization of heme-binding properties of Paracoccus denitrificans Surf1 proteins doc
... (5¢-ATATACATATGGCTAGCATGACTGGTGG ACAGCAAATGGGTCGCGGATCCATGTCGCGCCCG ATCGAGAA-3¢) introducing an N-terminal t7 tag and a NdeI site, and a reverse primer (5¢ -TATATCTCGAGT CA(ATGGTG) 3 GCCCTGAAAATAAA GATTC TCA CCC GGACCGGGACCTCGGACAGTTCCCCGGAC-3¢) ... of Surf1 may be imagined: (a) modulation of heme a synthase activity by abstracting the enzymatic end product, (b) supply of an...
Ngày tải lên: 06/03/2014, 00:21
Báo cáo Y học: Characterization of the exopolysaccharide produced by Streptococcus thermophilus 8S containing an open chain nononic acid doc
... neutralization and removal of boric acid by coevaporation with methanol, the mixture of partially methylated alditols was acetylated with acetic anhydride (3 h, 120 °C), and analyzed by GLC and GLC–EIMS ... D-(1fi4)-C-(1fi4)-E sequence. DISCUSSION Based on monosaccharide analysis, methylation analysis, and 1D/2D NMR studies ( 1 Hand 13 C) carried out on the native polysaccharide...
Ngày tải lên: 08/03/2014, 09:20