Báo cáo Y học: Characterization of heparin binding by a peptide from amyloid P component using capillary electrophoresis, surface plasmon resonance and isothermal titration calorimetry ppt

... Characterization of heparin binding by a peptide from amyloid P component using capillary electrophoresis, surface plasmon resonance and isothermal titration calorimetry Maria J. Hernaiz 1 , ... heparin binding capabilities. Keywords: amyloid P component; heparin binding; surface plasmon resonance; capillary electrophoresis; isothe...

Ngày tải lên: 31/03/2014, 23:20

... complementation with a wild-type HbpR expressed from another plasmid in the same cell (pHYBP124, Fig. 5D). The combinations pHYBP124, pHB164 (wild-type HbpR plus CBP–HbpR) and pHYBP124, pHYBP103 ... M (2004) ATP-dependent transcriptional activation by bac- terial PspF AAA+ protein. J Mol Biol 338, 863–875. 19 Tropel D & van der Meer JR (2002) Identification and physical characte...

Ngày tải lên: 07/03/2014, 17:20

... plasma and in PBS after addition of glutaraldehyde. Pravastatin assay by UPLC A reversed phase UPLC method was developed and used throughout the study for pravastatin assay. The mobile phase ... Research Paper Characterization of Human Erythrocytes as Potential Carrier for Pravas- tatin: An In Vitro Study Gamal El-din I. Harisa, Mohamed F. Ibrahim, Fars K. Alanazi  Dep...

Ngày tải lên: 25/10/2012, 11:10

... Naoto Aiba 6 and Tetsutaro Sata 1 1. Department of Pathology, National Institute of Infectious Diseases, Tokyo, Japan 2. Department of Transplantation Surgery, Nagoya University Hospital, ... factors such as posthepatitic aplasia, B19, and drugs. Langnas et al. [1] reported the possibility of B19 as the cause of non -A- C fulminant hepatitis-associated aplastic anemia....

Ngày tải lên: 26/10/2012, 10:03

... via auditory passive single-tone and passive oddball paradigms may similarly be effective when active responses are infeasible [63]. Further, P3 00 parameters may be affected by familiarization ... of cortical potential imaging methods to model responses to auditory stimuli supports the hypothesis of temporal- and spatial distinction of the Novelty P3 and parietal P3...

Ngày tải lên: 02/11/2012, 11:08

... (GeneBank accession num- ber AI975843). A 549-bp fragment was amplified by PCR using oligonucleotides GSTX1: 5¢- GTTGTCGACAAA CATCTCAACTAG-3 and GSTX3: 5¢-GTAAGTGTGG GAATAAGATCAAATC from adult S. mansoni ... (TGGAACTT ATCGTCAACTTTTCCATCC-3¢)forS. mansoni a- tubu- lin. SmGSTO amplification bands were quantified by using GelPro and normalized by comparing to a- tubulin ampli- fi...

Ngày tải lên: 21/02/2014, 01:21

... Invitrogen was used for expression. The gene was amplified with PCR from genomic Vibrio DNA using the primers 5¢-ATGTTAAA GAAAGTATTAAGTTGTTG-TATTGCAGC-3¢ and 5¢-AAAGTTTGCTTGGAGCGTCAAGCC-ACTGTAAG CCG-3¢, ... succinyl-AlaAlaProPhe -p- nitroanilide (Suc- AAPF-NH-Np), guanidinium thiocyanate (GdmSCN), and chemicals used for preparation of buffers were from the Sigma Chemical Company (S...

Ngày tải lên: 21/02/2014, 01:21

... ith a specific enz yme activity. Keywords: Bombyx mori; detoxication; insect; UDP- glycosyltransferase. The UDP-glycosyltransferases ( UGTs) are a superfamily of enzymes that p lay a central role ... Technology and Medicine, London SW7 2AZ, UK; 2 Laboratory of Molecular Entomology and Baculovirology, Riken, Wako, Japan Sugar conjugation is a major pathway for the inactivation...

Ngày tải lên: 22/02/2014, 04:20

... (5¢-ATATACATATGGCTAGCATGACTGGTGG ACAGCAAATGGGTCGCGGATCCATGTCGCGCCCG ATCGAGAA-3¢) introducing an N-terminal t7 tag and a NdeI site, and a reverse primer (5¢ -TATATCTCGAGT CA(ATGGTG) 3 GCCCTGAAAATAAA GATTC TCA CCC GGACCGGGACCTCGGACAGTTCCCCGGAC-3¢) ... of Surf1 may be imagined: (a) modulation of heme a synthase activity by abstracting the enzymatic end product, (b) supply of an...

Ngày tải lên: 06/03/2014, 00:21

... neutralization and removal of boric acid by coevaporation with methanol, the mixture of partially methylated alditols was acetylated with acetic anhydride (3 h, 120 °C), and analyzed by GLC and GLC–EIMS ... D-(1fi4)-C-(1fi4)-E sequence. DISCUSSION Based on monosaccharide analysis, methylation analysis, and 1D/2D NMR studies ( 1 Hand 13 C) carried out on the native polysaccharide...

Ngày tải lên: 08/03/2014, 09:20