Báo cáo Y học: Effect of ibuprofen and warfarin on the allosteric properties of haem– human serum albumin A spectroscopic study potx
Báo cáo Y học: Effect of ibuprofen and warfarin on the allosteric properties of haem– human serum albumin A spectroscopic study potx
... Effect of ibuprofen and warfarin on the allosteric properties of haem human serum albumin A spectroscopic study Simona Baroni1, Marco Mattu2, Alessandro Vannini2, Rita Cipollone2, ... not appear to be a likely candidate for the axial haem bonding.CONCLUSIONS The effect of ibuprofen and warfarin on the electronicabsorption spectroscopic, 1H-NMR relaxometric and X-band EPR spectroscopic ... extended conformation.Remarkably, ibuprofen, a nonsteroidal anti-inflammatoryagent [12], and warfarin, an anticoagulant drug [12], areconsidered as stereotypical ligands for Sudlow’s site II and Sudlow’s...
- 7
- 549
- 0
Báo cáo Y học: Holliday junction binding and processing by the RuvA protein of Mycoplasma pneumoniae ppt
... (TGCCGAATTCTACCAGTGCCAGTGAAGGACATCTTTGCCCACGTTGACCC), 4 ( CAACGTCATAGACGATTACATTG CTACATGGAGCTGTCTAGAGGATCCGA). A three-strandjunction was made by o mitting strand 4 and a 37-bp duplexDNA by annealing ... junc tion, J0, labelled with biotin ( bio) at the 5¢ end of one strand: 1 (bio-AAAAATGGGTCAACGTGGGCAAAGATGTCCTAGCAATGTAATCGTCTATGACGTT),2 ( GTCGGATCCTCTAGACAGCTCCATGTTCACTGGCACTGGTAGAATTCGGC), ... retardation assays confirming that MpRuvA has a reduced specificity for Holliday junctions. SPR analysis alsoshows that the EcRuvA and MpRuvA bind to the DNAwith fast association rate c onstants...
- 9
- 542
- 0
Tài liệu Báo cáo Y học: Soluble silk-like organic matrix in the nacreous layer of the bivalve Pinctada maxima A new insight in the biomineralization field pptx
... various charac-terization methods: fractionation by size-exclusion and anion-exchange HPLC, amino acid analysis, glycosami-noglycan and calcium quantification, SDS/PAGE and FTIR spectroscopy. ... to analyze the amino acid composition of the water insoluble matrix(WIM). Again we found a high content in Gly-Ala, and the global composition was very similar to the WSM, and consequently the ... of the water-soluble matrix, the EDTA-soluble matrix and the EDTA-insolublematrix of Pinctada maxima nacre. Sulfated and nonsulfated glycosaminoglycans from the supernatant were estimated by...
- 10
- 731
- 0
Tài liệu Báo cáo Y học: BIGH3 (TGFBI) Arg124 mutations influence the amyloid conversion of related peptides in vitro Implications in the BIGH3-linked corneal dystrophies pptx
... Fourier-deconvoluted and the secondary structure was determined by Gaussian curve-fitting. The calculation of each fraction of the total bandarea over the curve was performed with an overlapmethod after ... presented anintermediate degree of amyloid fibril formation.Cysteine has the capacity to form disulfide bonds. Asdisulfide bonding of the protein may participate in the appearance of aggregates and ... corneas,suggesting the existence of an abnormal degradation of the protein [22,24]. The second is the putative participation of local factors on the appearance of the disease. The TGFBIprotein, in addition...
- 8
- 469
- 0
Tài liệu Báo cáo Y học: Interallelic complementation provides genetic evidence for the multimeric organization of the Phycomyces blakesleeanus phytoene dehydrogenase doc
... Avda, Salamanca,Spain;2Centro Hispano-Luso de Investigaciones Agrarias, Universidad de Salamanca, Edi®ci o Departamental, Avda, Salamanca,Spain The Phycomyces blakesleeanus wild-type is yellow, ... strain A4 86 complemented carA, carRA and carCmutations. These observations allowed us to discard anypossible a lteration in genes carRA and carC in strain A4 86,in agreement with the data derived ... mutant allele was then namedcarB679.DISCUSSIONBiochemical and genetic analysis demonstrate that strain A4 86 has acquired a leaky mutation in the carB gene,originating the mutant allele carB679....
- 7
- 479
- 0
Báo cáo Y học: S-Decyl-glutathione nonspecifically stimulates the ATPase activity of the nucleotide-binding domains of the human multidrug resistance-associated protein, MRP1 (ABCC1) ppt
... whereas the stimulation decreased at higherconcentrations. At 1 mM of S-decyl-glutathione, the meas-ured ATPase activity represented approximately the basalATPase activity. This type of behaviour ... decanol did not show anystimulation, and caused a small, but significant and concentration-dependent inhibition of the ATPase activity. The ATPase activity of MBP–NBD2 was stimulated in the same ... gift of plasmid pJ3W, and Marjon Pasmooij, Sonja Albers and HeidiLandmesser for purified LmrA-NBD, GlcV, and MalK, respectively.H. W. v. V was a fellow of the Netherlands Academy of Art and Sciences.REFERENCES1....
- 9
- 564
- 0
Báo cáo Y học: Probing intermolecular protein–protein interactions in the calcium-sensing receptor homodimer using bioluminescence resonance energy transfer (BRET) potx
... work was supported by grants from the Danish MedicalResearch Council and the Novo Nordisk Foundation (AAJ, JLH, SPS and HBO), by the Lundbeck Foundation (AAJ) and by the DanishHeart Foundation ... GFP2-tagged CaRs and AT 1a Rs are similar.To evaluate the cell surface expression, we tagged HA and c-myc epitopes to the N-terminal of the CaR-GFP2 and CaR-Rluc fusion proteins, respectively, and ... not made theseconstructs.An alternate interpretation of the lack of agonist-inducedBRET observed in this study is that the translation of agonist binding to the ATDs of the family C GPCRhomodimer...
- 12
- 445
- 0
Báo cáo y học: " Effect of Weight Reduction on Cardiovascular Risk Factors and CD34-positive Cells in Circulatio"
... data were analyzed by Systat software (Sys-tat Inc) and KaleidaGraph software. Variables were presented as mean values ±SD. Statistical analysis was done by linear regression model and paired ... syndrome [30]. All these abnormalities cre-ate a state of constant and progressive damage to the vascular wall, manifested by a low-grade progressive inflammatory process and endothelial dysfunction ... weekly for all participants: fat free mass, body fat, BMI, extracellular/intracellular water, total body water and basal metabolic rate. For part of participants blood chemistry parameters and circulating...
- 8
- 594
- 0
Báo cáo y học: "Effect of Acute Administration of an Herbal Preparation on Blood Pressure and Heart Rate in Humans"
... 2 analysis of variance (ANOVA). For the first data analysis, treatment and time were the independent factors using all 23 subjects. The second analysis sep-arated and analyzed the data according ... Abstract Confusion and controversy exist regarding the cardiovascular effects of dietary supplements containing caffeine and Citrus aurantium (bitter orange) extract. The primary protoalkaloidal ... purpose of this study was to determine the effects of the acute ad-ministration of a product containing caffeine from guarana, p-synephrine from C. aurantium and a green tea polyphenolic extract...
- 6
- 490
- 0
Báo cáo Y học: Effect of the disease-causing mutations identified in human ribonuclease (RNase) H2 on the activities and stabilities of yeast RNase H2 and archaeal RNase HII pot
... bp[rA]29, [rA]4, and [rA]1as substrate. These oligomericsubstrates were prepared by hybridizing 1 lm of the 5¢-FAM-labeled 29 base DNA13-RNA4-DNA12(5¢-AATAGAGAAAAAGaaaaAAGATGGCAAAG-3¢) and ... DNA15-RNA1-DNA13(5¢-AATAGAGAAAAAGAAaAAAGATGGCAAAG-3¢) with a 1.5 molar equivalent of the comple-mentary DNA, respectively, as described previously [10]. Inthese sequences, DNA and RNA ... 5¢-TGTGGAATTCAGTGGTGGTGGTGGTGGTGCCGGTACCAATTATCTAGGG-3¢ for RNH 2A- R; 5¢-ATATGAATTCTCTCTAAGGAGATATACTTAT GACCGTTTC CAACATTGGG-3¢ for RNH2B-F; 5¢-GGGGAAGCTTCTAGTGGTGGTGGTGGTGGTGCTTACGTTTAAAAAATCCATC-3¢ for RNH2B-R; 5¢-ATATAAGCTTCTCTCAAGGAGATATACTTATGACCAAAGATGCCGTG-3¢...
- 14
- 482
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenvariety baking procedure and storage on the antioxidant properties of breads with added barley floursbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ