Báo cáo Y học: Effect of ibuprofen and warfarin on the allosteric properties of haem– human serum albumin A spectroscopic study potx
... Effect of ibuprofen and warfarin on the allosteric properties of haem human serum albumin A spectroscopic study Simona Baroni 1 , Marco Mattu 2 , Alessandro Vannini 2 , Rita Cipollone 2 , ... not appear to be a likely candidate for the axial haem bonding. CONCLUSIONS The effect of ibuprofen and warfarin on the electronic absorption spectrosc...
Ngày tải lên: 31/03/2014, 23:20
... (TGCCGAATTCTA CCAGTGCCAGTGAAGGACATCTTTGCCCACGTTG ACCC), 4 ( CAACGTCATAGACGATTACATTG CTAC ATGGAGCTGTCTAGAGGATCCGA). A three-strand junction was made by o mitting strand 4 and a 37-bp duplex DNA by annealing ... junc tion, J0, labelled with biotin ( bio) at the 5¢ end of one strand: 1 (bio-AAAAATGGGTCAACGTGGGCAA AGATGTCCTAGCAATGTAATCGTCTATGACGTT), 2 ( GTCGGATCCTCTAGACAGCTCCATGTTCACTG...
Ngày tải lên: 17/03/2014, 17:20
... various charac- terization methods: fractionation by size-exclusion and anion-exchange HPLC, amino acid analysis, glycosami- noglycan and calcium quantification, SDS/PAGE and FTIR spectroscopy. ... to analyze the amino acid composition of the water insoluble matrix (WIM). Again we found a high content in Gly-Ala, and the global composition was very similar to the WSM, and...
Ngày tải lên: 21/02/2014, 01:21
Tài liệu Báo cáo Y học: BIGH3 (TGFBI) Arg124 mutations influence the amyloid conversion of related peptides in vitro Implications in the BIGH3-linked corneal dystrophies pptx
... Fourier-deconvoluted and the secondary structure was determined by Gaussian curve- fitting. The calculation of each fraction of the total band area over the curve was performed with an overlap method after ... presented an intermediate degree of amyloid fibril formation. Cysteine has the capacity to form disulfide bonds. As disulfide bonding of the protein may participate in...
Ngày tải lên: 21/02/2014, 01:21
Tài liệu Báo cáo Y học: Interallelic complementation provides genetic evidence for the multimeric organization of the Phycomyces blakesleeanus phytoene dehydrogenase doc
... Avda, Salamanca, Spain; 2 Centro Hispano-Luso de Investigaciones Agrarias, Universidad de Salamanca, Edi®ci o Departamental, Avda, Salamanca, Spain The Phycomyces blakesleeanus wild-type is yellow, ... strain A4 86 complemented carA, carRA and carC mutations. These observations allowed us to discard any possible a lteration in genes carRA and carC in strain A4 86, in agreement with...
Ngày tải lên: 22/02/2014, 04:20
Báo cáo Y học: S-Decyl-glutathione nonspecifically stimulates the ATPase activity of the nucleotide-binding domains of the human multidrug resistance-associated protein, MRP1 (ABCC1) ppt
... whereas the stimulation decreased at higher concentrations. At 1 m M of S-decyl-glutathione, the meas- ured ATPase activity represented approximately the basal ATPase activity. This type of behaviour ... decanol did not show any stimulation, and caused a small, but significant and concentration-dependent inhibition of the ATPase activity. The ATPase activity of MBP–NBD2...
Ngày tải lên: 17/03/2014, 23:20
Báo cáo Y học: Probing intermolecular protein–protein interactions in the calcium-sensing receptor homodimer using bioluminescence resonance energy transfer (BRET) potx
... work was supported by grants from the Danish Medical Research Council and the Novo Nordisk Foundation (AAJ, JLH, SPS and HBO), by the Lundbeck Foundation (AAJ) and by the Danish Heart Foundation ... GFP 2 -tagged CaRs and AT 1a Rs are similar. To evaluate the cell surface expression, we tagged HA and c-myc epitopes to the N-terminal of the CaR-GFP 2 and CaR-Rluc...
Ngày tải lên: 08/03/2014, 09:20
Báo cáo y học: " Effect of Weight Reduction on Cardiovascular Risk Factors and CD34-positive Cells in Circulatio"
... data were analyzed by Systat software (Sys- tat Inc) and KaleidaGraph software. Variables were presented as mean values ±SD. Statistical analysis was done by linear regression model and paired ... syndrome [30]. All these abnormalities cre- ate a state of constant and progressive damage to the vascular wall, manifested by a low-grade progressive inflammatory process and en...
Ngày tải lên: 25/10/2012, 10:51
Báo cáo y học: "Effect of Acute Administration of an Herbal Preparation on Blood Pressure and Heart Rate in Humans"
... 2 analysis of variance (ANOVA). For the first data analysis, treatment and time were the independent factors using all 23 subjects. The second analysis sep- arated and analyzed the data according ... Abstract Confusion and controversy exist regarding the cardiovascular effects of dietary supplements containing caffeine and Citrus aurantium (bitter orange) extract....
Ngày tải lên: 25/10/2012, 11:10
Báo cáo Y học: Effect of the disease-causing mutations identified in human ribonuclease (RNase) H2 on the activities and stabilities of yeast RNase H2 and archaeal RNase HII pot
... bp [rA] 29 , [rA] 4 , and [rA] 1 as substrate. These oligomeric substrates were prepared by hybridizing 1 lm of the 5¢-FAM-labeled 29 base DNA 13 -RNA 4 -DNA 12 (5¢-AATA GAGAAAAAGaaaaAAGATGGCAAAG-3¢) and ... DNA 15 - RNA 1 -DNA 13 (5¢-AATAGAGAAAAAGAAaAAAGATG GCAAAG-3¢) with a 1.5 molar equivalent of the comple- mentary DNA, respectively, as described previously [10]. In these se...
Ngày tải lên: 17/03/2014, 17:20