Báo cáo Y học: A neuropeptide Y receptor Y1-subfamily gene from an agnathan, the European river lamprey doc

Báo cáo Y học: A neuropeptide Y receptor Y1-subfamily gene from an agnathan, the European river lamprey doc

Báo cáo Y học: A neuropeptide Y receptor Y1-subfamily gene from an agnathan, the European river lamprey doc

... A neuropeptide Y receptor Y1 -subfamily gene from an agnathan, the European river lamprey A potential ancestral gene Erik Salaneck 1 , Robert Fredriksson 1 , Earl T. Larson 1 , J. Michael ... subtypes. The mammalian Y1 , Y4 and y6 subtypes are < 50% identical at the amino-acid level, and form the Y1 subfamily. The Y2 and Y5 genes are only 30% ide...

Ngày tải lên: 31/03/2014, 23:20

9 290 0
Tài liệu Báo cáo khoa học: Epidermal growth factor receptor in relation to tumor development: EGFR-targeted anticancer therapy doc

Tài liệu Báo cáo khoa học: Epidermal growth factor receptor in relation to tumor development: EGFR-targeted anticancer therapy doc

... lung can- cer with epidermal growth factor receptor mutations. Br J Cancer 95, 998–1004. 16 Sutani A, Nagai Y, Udagawa K, Uchida Y, Koyama N, Murayama Y, Tanaka T, Miyazawa H, Nagata M, Kanazawa ... 3340–3346. 15 Asahina H, Yamazaki K, Kinoshita I, Sukoh N, Harada M, Yokouchi H, Ishida T, Ogura S, Kojima T, Okamoto Y et al. (2006) A phase II trial of gefitinib as first-line therapy fo...

Ngày tải lên: 16/02/2014, 09:20

7 511 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

... GGGTTCT AACAAG GGTGCT-3¢;Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab- start, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢;Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢. The ... Ab(1–40) and Ab(M1–40) are at least 97% pure. In the lanes containing Ab(1–42) and Ab(M1– 42), there were prominent bands at approximately 4 kDa and faint bands at approximately 14 k...

Ngày tải lên: 18/02/2014, 13:20

16 691 0
Tài liệu Báo cáo khoa học: "A Large Scale Distributed Syntactic, Semantic and Lexical Language Model for Machine Translation" doc

Tài liệu Báo cáo khoa học: "A Large Scale Distributed Syntactic, Semantic and Lexical Language Model for Machine Translation" doc

... Stochastic analysis of lexical and semantic enhanced structural language model. The 8th International Colloquium on Grammatical Inference (ICGI), 97-111. K. Yamada and K. Knight. 2001. A syntax-based ... Stochastic analysis of structured lan- guage modeling. Mathematical Foundations of Speech and Language Processing, 37-72, Springer-Verlag. D. Jurafsky and J. Martin. 2008. Speech and Lang...

Ngày tải lên: 20/02/2014, 04:20

10 568 0
Tài liệu Báo cáo khoa học: "A Limited-Domain English to Japanese Medical Speech Translator Built Using REGULUS 2" doc

Tài liệu Báo cáo khoa học: "A Limited-Domain English to Japanese Medical Speech Translator Built Using REGULUS 2" doc

... light make the headache worse?” as a variant for “Is the headache aggra- vated by bright light?”, and “Do you usually have headaches in the morning?” as a variant for “Does the headache usually occur ... phrasebook translator, it has many desir- able properties. In particular, operations on semantic representations typically manipulate lists rather than trees. In a broad domain,...

Ngày tải lên: 20/02/2014, 16:20

4 393 0
Tài liệu Báo cáo khoa học: "A Text Input Front-end Processor as an Information Access Platform" doc

Tài liệu Báo cáo khoa học: "A Text Input Front-end Processor as an Information Access Platform" doc

... English' and &apos ;a pen'. 3 The Japanese terms Shoseki and Renzu mean, respectively, 'written materials' and &apos ;a lens'• 4 The Japanese terms Reibun and Bainda ... Miyazaki, Miyamae-ku, Kawasaki, KANAGAWA 216-8555 JAPAN s-doi@ccm.cl.nec.co.jp, kamei@ccm.cl.nec.co.jp, yamabana@ccm.cl.nec.co.jp Abstract This paper presents a practical foreign...

Ngày tải lên: 20/02/2014, 18:20

5 385 0
Tài liệu Báo cáo khoa học: "A Method for Correcting Errors in Speech Recognition Using the Statistical Features of Character Co-occurrence" pptx

Tài liệu Báo cáo khoa học: "A Method for Correcting Errors in Speech Recognition Using the Statistical Features of Character Co-occurrence" pptx

... segments of an utterance by cooperatively using both grammatical and n-gram based statistical language constraints, and uses a robust parsing technique to apply the grammatical constraints described ... Hoteru yoyaku gakari de gozaimasu", ('l'hank you for calling Kyoto Kanko Hotel reservations.) Input String: -¢, " ;A hai arigatou gozaimasu e Kyoto Kanko Hote...

Ngày tải lên: 20/02/2014, 18:20

5 588 0
Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc

Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc

... Odintsova 1 , Alexander A. Vassilevski 2 , Anna A. Slavokhotova 1 , Alexander K. Musolyamov 2 , Ekaterina I. Finkina 2 , Natalia V. Khadeeva 1 , Eugene A. Rogozhin 2 , Tatyana V. Korostyleva 1 , Vitalii ... GTAAGTACGGCTTCTGCGGTTCTGGTGACGCTTACTGTGG 4f CGCTGGTTCTTGCCAGTCTCAGTGCCGTGGTTGCTAG GGAT 1r TTTAGCACCACGAGCCTGGTCACCGCAACGCTGAGC 2r CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG 3r GACTGGCAAGAACCA...

Ngày tải lên: 07/03/2014, 02:20

10 505 0
Báo cáo khoa học: Functional characterization of front-end desaturases from trypanosomatids depicts the first polyunsaturated fatty acid biosynthetic pathway from a parasitic protozoan ppt

Báo cáo khoa học: Functional characterization of front-end desaturases from trypanosomatids depicts the first polyunsaturated fatty acid biosynthetic pathway from a parasitic protozoan ppt

... desaturase (Fig. 5). On the other hand, the phylogenetic analysis locates L. major D4 desaturase in a subgroup with the same enzymes from trypano- somes and the microalga Pav. lutheri, and separated from ... major branch, mainly containing D6 desatu- rases from lower and higher eukaryotes and the D8 desaturase from E. gracilis. It is reasonably clear from the analysis...

Ngày tải lên: 07/03/2014, 12:20

10 476 0
Báo cáo khoa học: A steady-state modeling approach to validate an in vivo mechanism of the GAL regulatory network in Saccharomyces cerevisiae ppt

Báo cáo khoa học: A steady-state modeling approach to validate an in vivo mechanism of the GAL regulatory network in Saccharomyces cerevisiae ppt

... mecha- nisms. The response curve can b e quantified by a Hill equation and is c haracterized by two p arameters, namely, the Hill coefficient and the half saturation constan t. T he Hill coefficient is a measure ... mathemat- ical models to obtain meaningful insights. Examples of such regulatory networks with detail ed mechanisms include the tryptophan and arabinose systems of Escher...

Ngày tải lên: 07/03/2014, 16:20

11 490 0
Từ khóa:
w