Báo cáo Y học: Expression of recombinant murine pregnancy-associated plasma protein-A (PAPP-A) and a novel variant (PAPP-Ai) with differential proteolytic activity pot
Báo cáo Y học: Expression of recombinant murine pregnancy-associated plasma protein-A (PAPP-A) and a novel variant (PAPP-Ai) with differential proteolytic activity pot
... 2002 Expression of recombinant murine pregnancy-associated plasma protein -A (PAPP -A) and a novel variant (PAPP-Ai) with differential proteolytic activity Rikke Søe 1 , Michael T. Overgaard 1 , Anni R. ... USA Murine pregnancy-associated plasma protein -A (PAPP -A) cDNA encoding a 1545 amino-acid protein has been cloned. We have also identifi...
Ngày tải lên: 31/03/2014, 21:21
Báo cáo Y học: Expression of the aspartate/glutamate mitochondrial carriers aralar1 and citrin during development and in adult rat tissues docx
... bands. The analysis indicated that spleen, heart (particularly the ventricle), ovary, and stomach have similar levels of citrin and aralar1. Liver, kidney, whole pancreas and testis clearly have higher ... b-F 1 ATPase. (C) Western blot analysis of aralar1 and citrin in auricular and ventricular myocardium. 20 lg of atria (A) and ventricle (V) mitochondrial extracts from two...
Ngày tải lên: 24/03/2014, 04:21
Báo cáo y học: "Expression of Human Globular Adiponectin-Glucagon-Like Peptide-1 Analog Fusion Protein and Its Assay of Glucose-Lowering Effect In Vivo"
... Statistical analysis Data were expressed as means ± standard devi- ations. Data were analyzed using one-way analysis of variance and secondary analysis for significance with the Turkey-Kramer ... size, and may circumvent the rapid inactivation and renal clearance of GLP-1. Studies have reported N-terminus is very important for the biological activity of GLP-1, and for...
Ngày tải lên: 25/10/2012, 11:10
Báo cáo y học: "Expression of hMSH2 protein of the human DNA mismatch repair system in oral lichen planus"
... forms are usually painless and appear clinically as white keratotic lesions. The erosive, atrophic and bullous forms are often associated with a burning sensation and in many cases can cause ... degeneration of basal keratinocytes, hyperkeratinization and acanthosis [24]. Basal cells are the prime target of destruction in OLP. The mechanism of basal cell damage is related...
Ngày tải lên: 03/11/2012, 09:54
Báo cáo Y học: Expression of the V-ATPase proteolipid subunit of Acetabularia acetabulum in a VMA3-deficient strain of Saccharomyces cerevisiae and study of its complementation pdf
... identity). AACEVAPD1 AACEVAPD3 AACEVAPD2 AACEVAPD5 AACEVAPD4 AACEVAPD6 Vma3p Vma11p Vma16p AACEVAPD1 100 AACEVAPD3 97 100 AACEVAPD2 80 80 100 AACEVAPD5 80 80 94 100 AACEVAPD4 80 79 93 94 100 AACEVAPD6 ... case of AACEVAPD1, 3 and 6, TAA is used as an Acetabularia-specific codon usage (translated as Gln). Conversion of TAA to CAA was performed by PCR as described below. AACEVAPD1 has two...
Ngày tải lên: 08/03/2014, 23:20
Báo cáo Y học: Expression of uncoupling protein-3 in subsarcolemmal and intermyofibrillar mitochondria of various mouse muscle types and its modulation by fasting docx
... human UCP3 allowed clear validation of our Western blot signal. Good cross-reactivity of the CabrX antibody with mouse recombinant UCP3 was also demonstrated. The signals can be quantitated and compared ... chemiluminescence using a standard ECL kit and developed Hyperfilm ECL film. They were quantified by scanning photodensitometry using ImageQuant Software 3.3 (Molecular Dynamics...
Ngày tải lên: 24/03/2014, 04:21
Báo cáo Y học: Expression of glucose transporter-2, glucokinase and mitochondrial glycerolphosphate dehydrogenase in pancreatic islets during rat ontogenesis potx
... change in A 412 before the addition of oxalacetate (which is acetyl-CoA hydrolase activity) from the change in A 412 after addition of oxalace- tate. Succinate dehydrogenase activity [18] was ... 20-day-old suckling and adult rats was isolated by the a cid/guanidinium isothiocyanate method [16]. Total RNA was size-fractionated t hrough a 1.3% agarose/formaldehyde gel an d tra...
Ngày tải lên: 31/03/2014, 15:20
Báo cáo Y học: Expression of the uncoupling protein 1 from the aP2 gene promoter stimulates mitochondrial biogenesis in unilocular adipocytes in vivo potx
... (5¢)3¢) Antisense primer (5¢)3¢) GenBank acc. no. COX IV a AGAAGGCGCTGAAGGAGAAGGA CCAGCATGCCGAGGGAGTGA NM_009941 NRF-1 ATGGGCCAATGTCCGCAGTGATGTC GGTGGCCTCTGATGCTTGCGTCGTCT AF098077 b-actin GAACCCTAAGGCCAACCGTGAAAAGAT ... (A and B) and adult (C and D) control (A and C) and transgenic (B and D) mice. (A) The depot is composed of unilocular and multilocular adipocytes. Only...
Ngày tải lên: 31/03/2014, 15:20
Báo cáo y học: " Effect of Weight Reduction on Cardiovascular Risk Factors and CD34-positive Cells in Circulatio"
... data were analyzed by Systat software (Sys- tat Inc) and KaleidaGraph software. Variables were presented as mean values ±SD. Statistical analysis was done by linear regression model and paired ... weekly for all participants: fat free mass, body fat, BMI, extracellular/intracellular water, total body water and basal metabolic rate. For part of participants blood chemistry paramete...
Ngày tải lên: 25/10/2012, 10:51
Báo cáo y học: "Effects of Flurbiprofen on CRP, TNF-α, IL-6, and Postoperative Pain of Thoracotomy"
... inflammatory state characterized by the release of both proinflammatory and antiinflammatory proteins. Proinflammatory cy- tokines induce not only a local inflammation at the site of injury, ... Surgery, Konya Education and Research Hospital, Konya, Turkey; 2. Microbiology Laboratory, Konya Education and Research Hospital, Konya, Turkey Corresponding author: Recep Kesli, MD....
Ngày tải lên: 25/10/2012, 11:10