Báo cáo khoa học: "LEXICAL AND SYNTACTIC RULES IN A TREE ADJOINING GRAMMAR" pdf

... LEXICAL AND SYNTACTIC RULES IN A TREE ADJOINING GRAMMAR Anne Abeill6* LADL and UFRL University of Paris 7-Jussieu abeille@zeta.ibp.fr ABSTRACT according to this definition 2. Each elementary ... lexical constraints (on top of syntactic, and possibly semantic, ones). We show that such puzzling phenomena are naturally handled in a 'lexJcalized' formalis...

Ngày tải lên: 31/03/2014, 18:20

...

Ngày tải lên: 20/02/2014, 18:20

... linguistic information will be available to address derivation/compounding. Since the nec- essary generative capacity is available in the syntac- tic grammar anyway, it seems reasonable to leave more ... part-of- speech category and morphosyntactic agreement in- formation, it is certainly important for information extraction, information retrieval, and higher-level tasks like machine...

Ngày tải lên: 23/03/2014, 19:20

... 4038–4049. 20 Nanba H, Yajima K, Takano M, Yamada Y, Ikenaka Y & Takahashi S (1997) Process for producing d-N-car- bamoyl -a- amino acid. European Patent Application No. EP080113 1A1 . 21 Abendroth J, ... evolution and structural analysis of N-carbamoyl-d-amino acid amidohydrolase provide insights into recombinant Y. Cai et al. A novel high-activity D-hydantoinase from Jannaschia sp....

Ngày tải lên: 18/02/2014, 08:20

... enterica Typhimurum strain IFO12529 genomic DNA as the template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing ... pro- tein is made up of a nine-stranded b-sheet flanked by a1 , a5 and g2 on one side and by a2 , a3 , a4 and g1 Structure of Salmonella typhimurium SurE A. Pappachan et al. 585...

Ngày tải lên: 18/02/2014, 14:20

... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢. For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the C-terminus ... puri- fied, and annealed. The Not1 site in the resulting gene was removed using the complementary oligomers 5¢-GGCGGGAGGGGCGATAATTTTATCGCGTTAAAA CCG-3¢ (forward) and...

Ngày tải lên: 19/02/2014, 06:20

... A has no outgoing edges, we add an edge A → U. We define a legal unassigned path as a di- rected path A 0 → A 1 → . . . → A n → A n+1 where A 0 and A n+1 are assigned satisfying Avg (A 0 ) ≤ Avg (A n+1 ) ... Patrick Pantel and Marco Pennacchiotti. 2006. Espresso: leveraging generic patterns for automat- ically harvesting semantic relations. COLING-ACL ’06. Deepak Ravi...

Ngày tải lên: 20/02/2014, 04:20

... on Computational Linguistics (COLING’10), Beijing, China. Alexandru Ceaus¸u, John Tinsley, Jian Zhang, and Andy Way. 2011. Experiments on domain adap- tation for patent machine translation in the ... Ueffing, Gholamreza Haffari, and Anoop Sarkar. 2007. Transductive learning for statistical machine translation. In Proceedings of the 45th An- nual Meeting of the Association of Computatio...

Ngày tải lên: 22/02/2014, 03:20

... Cryphonectria parasitica [9] and in the biosynthesis of cinnabarinic acid, a fungal metabolite produced by Pycnoporus cinnabarinus that exhibits anti- microbial activity against various bacterial species ... °Cfor20s,52°Cfor20s and 70 °C for 2 min; then a final extension at 72 °C for 10 min. The primers for lac1 P LAC1F (5¢-AGCTTT CATTCCCAGTGATTG-3¢)andP LAC1R (5¢-AACGAG CTCAAGTACAAA...

Ngày tải lên: 07/03/2014, 15:20

... target). Zebrafish maintenance and preparation of eggs TAB zebrafish were reared and maintained on a light ⁄ dark cycle essentially as described by Westerfield [49]. All experi- ments and fish maintenance ... JQ & Martindale MQ (1996) Dual origins of mesoderm in a basal spiralian: cell lineage analyses in the polyclad turbellarian Hoploplana inqui- lina. Dev Biol 179, 329–338. 4...

Ngày tải lên: 07/03/2014, 21:20