Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green fluorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc

Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green fluorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc

Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green fluorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc

... CCATGCCTATGATACTGGGAT-3¢ GSTM1-revA 5¢- CTAAAGATGAGACAGGCCTGG-3¢ GSTM1-revB 5¢-GATCCTAAAGATGAGACAGGCCTGG-3¢ GSTM2-forA 5¢-AATTCGATGCCTATGACACTGGGTTAC-3¢ GSTM2-forB 5¢- CGATGCCTATGACACTGGGTTAC-3¢ GSTM2-revA ... 4 AS-6 ACAAAGCATGATGAGCTGCA CDS 326–345 – 8 AS-7 GAGTA GAGCTTCATCTTCTC CDS 397–426 – 1 AS-8 ACTGGTCAAGAATGTCATAA CDS 480–499 – 7 AS-9 CAGGTTTGGGAAGGCGTCCA CDS 524–543 524–543 0 AS-10 CA...
Ngày tải lên : 31/03/2014, 15:20
  • 10
  • 432
  • 0
Báo cáo y học: "Medical resource utilization among patients with ventilator-associated pneumonia: pooled analysis of randomized studies of doripenem versus comparators"

Báo cáo y học: "Medical resource utilization among patients with ventilator-associated pneumonia: pooled analysis of randomized studies of doripenem versus comparators"

... overall mortality and, in patients with P. aeruginosa at baseline, minimal inhibitory concentrations (MIC), eradication rate, and resource utilization were evaluated. Statistical analyses Medical ... duration of mechanical ventilation was 10 days for all patients with VAP and 13 days for the subset with P. aeruginosa at baseline. Vidaur and colleagues [5] reported that, when pa...
Ngày tải lên : 25/10/2012, 10:02
  • 10
  • 557
  • 1
Báo cáo Y học: Human bile salt-stimulated lipase has a high frequency of size variation due to a hypervariable region in exon 11 pot

Báo cáo Y học: Human bile salt-stimulated lipase has a high frequency of size variation due to a hypervariable region in exon 11 pot

... feto-acinar pancreatic p rotein (FAPP), has been d etected in human embryonic and fetal pancreas and in pancreatic tumoral cell lines [35,36]. FAPP and BSSL are structurally closely related, but are ... blot analysis, 10 lg of DNA was digested with appropriate restriction enzyme(s). Digested DNA was separated on an agarose gel, transferred to a Hybond-N ®lter (Amersham) and hybr...
Ngày tải lên : 24/03/2014, 03:21
  • 9
  • 520
  • 0
Báo cáo khoa học: "Modeling Human Sentence Processing Data with a Statistical Parts-of-Speech Tagger" ppt

Báo cáo khoa học: "Modeling Human Sentence Processing Data with a Statistical Parts-of-Speech Tagger" ppt

... study, a total of 76 sentences were tested: 10 for lexical category ambiguity, 12 for RR ambiguity, 20 for PP attachment ambigu- ity, 16 for DO/SC ambiguity, and 18 for clausal boundary ambiguity. ... previous researchers have assumed, following standard linguistic the- ory, that a formally adequate account of recur- sive syntactic structure is an essential component of any model...
Ngày tải lên : 17/03/2014, 04:20
  • 6
  • 344
  • 0
Báo cáo khoa học: "Encoding Lexicalized Tree Adjoining Grammars with a Nonmonotonic Inheritance Hierarchy" potx

Báo cáo khoa học: "Encoding Lexicalized Tree Adjoining Grammars with a Nonmonotonic Inheritance Hierarchy" potx

... the same way that the covariation of, say, syntactic and mor- phological form is treated. In particular, we can use the mechanisms that DATR already provides for fea- ture covariation, rather ... Many of these trees have structure in common, many of the lexemes have the same tree families, and many of the trees within families are systematically rela- ted in ways which other...
Ngày tải lên : 17/03/2014, 09:20
  • 8
  • 349
  • 0
Báo cáo khoa học: "Pattern Learning for Relation Extraction with a Hierarchical Topic Model" pptx

Báo cáo khoa học: "Pattern Learning for Relation Extraction with a Hierarchical Topic Model" pptx

... may need to be adapted to dif- ferent languages and domains. Manually selected seeds can also be used (Ravichandran and Hovy, 2002; Kozareva and Hovy, 2010). The main contribution of this work ... that are expressing the relation and those that are ambiguous and can be applied across relations. In this way, high-precision extraction patterns can be learned without the need of an...
Ngày tải lên : 30/03/2014, 17:20
  • 6
  • 373
  • 0
 Báo cáo y học: "Comparative study of control selection in a national population -based case-control study: Estimating risk of smoking on cancer deaths in Chinese men"

Báo cáo y học: "Comparative study of control selection in a national population -based case-control study: Estimating risk of smoking on cancer deaths in Chinese men"

... urban than in rural areas, and for cancers with a high death rate than for ‘rare’ cancers. The possible expla- nations may be: (1) some rare cancer death rates are too low to be stable; (2) a ... initial design and final analysis based on symmetric CIs for estimation using a normal CI ap- proach. Second, a large adequate sample size in each compared group will make a high...
Ngày tải lên : 26/10/2012, 09:48
  • 9
  • 532
  • 1
Báo cáo y học: " A retrospective quality assessment of pre-hospital emergency medical documentation in motor vehicle accidents in south-eastern Norway"

Báo cáo y học: " A retrospective quality assessment of pre-hospital emergency medical documentation in motor vehicle accidents in south-eastern Norway"

... 80% of cases by ground and 92% of cases by air ambulance. Conclusion: EMS documentation of logistic and mechanistic variables was adequate. Patient physiology was frequently documented only as ... secure patient information storage, and allow for rapid, reli- able retrieval of data for clinical audit and research • Patient ID, date of accident and all patient encoun- ter t...
Ngày tải lên : 25/10/2012, 09:56
  • 11
  • 705
  • 1
 Báo cáo y học: "The epidemiology of medical emergency contacts outside hospitals in Norway - a prospective population based study"

Báo cáo y học: "The epidemiology of medical emergency contacts outside hospitals in Norway - a prospective population based study"

... possible NACA 5 Acute vital (life threatening) danger NACA 6 Acute cardiac or respiratory arrest NACA 7 Death Zakariassen et al. Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine ... chose and cooperated with a stra- tegic sample of three EMCCs, located at Haugesund, Stavanger and Innlandet hospitals, covering Rogaland, southern part of Hordaland, Hedmark,...
Ngày tải lên : 25/10/2012, 09:56
  • 9
  • 784
  • 0
 Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"

Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"

... Norwegian Air Ambulance Foundation, Drøbak, Norway. 2 Department of Anaesthesiology and Intensive Care, Stavanger University Hospital, Stavanger, Norway. 3 Department of Surgical Sciences, Faculty of ... data are available on the actual quality and safety of anaesthesiologist-managed pre-hospital endotracheal intubation (ETI). To explore whether the general indications for ETI are...
Ngày tải lên : 25/10/2012, 09:56
  • 6
  • 611
  • 0

Xem thêm