descriptions of selected accidents that have occurred at nuclear reactor potx
Metaphor, based on the association of similarity, is one of the two basic types of semantic transference that have been an interest for many linguistic researchers
... (1994:341) states that: “ lexical selection is just one aspect of lexicogrammatical selection, or wording; and that metaphorical variation is lexicogrammatical rather than simply An investigation ... states that “Metaphorical modes of expression are characteristic of all adult discourse”. Secondly, as stated above, the literature on the linguistic expression of emotions suggests a relatively ... realization of meaningAn investigation into the role of metaphor in description of emotion in poetic discourse19for believing that the context of (linguistic) emotional expression may be a profitable...
- 53
- 1,013
- 3
Báo cáo khoa học: Reduced FAS transcription in clones of U937 cells that have acquired resistance to Fas-induced apoptosis ppt
... methylationsor other global chromatin modifications, have recentlyreceived increasing attention in cancer research, as ithas become evident that alterations in methylationstatus are one of several ... cell death is a prerequisite for the elimination of tumourcells by cytotoxic immune cells, chemotherapy or irradiation. Activation of the death receptor Fas is critical for the regulation of immune ... data illustrate that Fas resistance can becaused by reduced Fas expression, which is a result of an unidentifiedmode of regulation.AbbreviationsAKT, protein kinase B; CpG, cytosine-phosphate-guanine;...
- 12
- 411
- 0
Interactions of Chemical Variations and Biocide Performance at Paper Machines potx
... wastewater to the wastewater treatment plant, which means that even in the most closed mill system, fresh water is needed to compensate this loss of water. Figure 2 illustrates the water balance ... most often faced in the white water systems when these components accumulate. White water in papermaking is described as water that has been used at least once before. It means that white water ... 25stability of the system and further the flocculation and coagulation. Figure 5 illustrates how different forces attract and repulse the particles, what is the effect of salt concentration, and what...
- 128
- 345
- 0
Báo cáo khoa học: ATPase activity of RecD is essential for growth of the Antarctic Pseudomonas syringae Lz4W at low temperature potx
... rate of ATP hydrolysis) for the reactions werecalculated. Km(ATP)was determined at a saturating concen-tration (1 lm) of ssDNA, and Km(DNA)was calculated at asaturating concentration of ... (Graphpad Software, San Diego, CA,USA). In each case, Vmax(maximal rate of ATP hydroly-sis), Km(ATP)(ATP concentration at the half-maximal rate of reaction) and Km(DNA)(DNA concentration at the ... significance of the RecD-associated ATPase activity required during the growth of P. syringae at low temperature (4 °C). The very low(but non-zero) ATPase activity of RecD (approxi-mately 8–10% of the...
- 17
- 326
- 0
Tài liệu Control the Creation and Behavior of Classes Now that you have code that can prepare all of the pdf
... Control the Creation and Behavior of Classes Now that you have code that can prepare all of the objects you need to access and update data in the database, it's time to write code that can load ... a matching method that writes the current state of the object to the data row just prior to saving changes to the database. Comments Inheritance is another OO term that simply means that all ... row. The second was to have a Retrieve method that would accept a primary key value and load the data from that one row. The problem with both of these techniques was that you could never be...
- 7
- 356
- 0
Báo cáo khoa học: Site-directed mutagenesis of selected residues at the active site of aryl-alcohol oxidase, an H2O2-producing ligninolytic enzyme pot
... amonomeric glycoprotein of 70 kDa with dissociableflavin-adenine dinucleotide (FAD) as cofactor that catalyzes the oxidation of a variety of aromatic andaliphatic polyunsaturated alcohols to their ... verysimilar to that of wild-type AAO (Fig. 3A) withabsorption maxima at 387 and 463 nm, indicating that the cofactor was in the oxidized state and correctlyincorporated. The absorption maxima of L315A ... site-directedmutagenesis.Mutations Primer sequences (5¢-to3¢)Y78A GGTCGGTCAATTGCGGCTCCTCGCGGCCGTATGY92A GGTCTAGCTCTGTTCACGCCATGGTCATGATGCGY92F GGTCTAGCTCTGTTCACTTCATGGTCATGATGCGL315A CCGACCATTTGGCCCTTCCTGCTGCCF501A...
- 11
- 471
- 0
An Account of Some of the Principal Slave Insurrections, and Others, Which Have Occurred, or Been Attempted, in the United States and Elsewhere, During the Last Two Centuries. pptx
... learn that the advocates of immediate emancipation are the only true friends of bothslaveholders and slaves, and that the only path of safety is the path of duty, which demands the immediaterepentance ... effects of theemancipation of the slaves. The great massacres and conflagrations which at that time made so frightful apicture in the history of this unhappy island, occurred in the days of slavery, ... positively known, that a great many of our profligate andabandoned whites (who are distinguished by the burlesque appellation of democrats) are implicated with theblacks, and would have joined them...
- 25
- 523
- 0
Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works
... husband for that. The ending of the story that Norma and her husband splitted up in Shiloh was the beginning of another war, the war between Norma Jean and her mother. It is undeniable that, the ... the news that you are not alone ” (Bynum, as cited in Morre, 2004, p. 435) This note is to show that a literary work is the fruit of the ponderation of the writer for the understanding of different ... and stimulate the analysis and interpretation of the readers. All of the techniques used in the story are to contribute to the success of the writer in achieving his ultimate goal, that is, as...
- 49
- 785
- 1
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ