Báo cáo khoa học: NMR and MS evidences for a random assembled O-specific chain structure in the LPS of the bacterium Xanthomonas campestris pv Vitians A case of unsystematic biosynthetic polymerization potx
Báo cáo khoa học: NMR and MS evidences for a random assembled O-specific chain structure in the LPS of the bacterium Xanthomonas campestris pv. Vitians A case of unsystematic biosynthetic polymerization potx
... (B ¼ b-Rha,
A ¼ a- Rha,
A ¼ a- Fuc3NAc (1fi2) a- Rha)
B A, B–
A
B A A, B A
A, B A A, B A A
B A A A, B A A
A, B A A A, B A A A, B A A A,
B–
A A A, B A A A, B A A A
Several of these combinations were ... NMR and MS evidences for a random assembled O-specific chain
structure in the LPS of the bacterium
Xanthomonas campestris
pv.
Vitians
A...
Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx
... highly variable C-terminal domain after the
terminal conserved arginine of the cytoplasmic serine ⁄
threonine kinase domain. Sequences for phylogenetic rela-
tionships of the extracellular part were ... housekeeping gene by using the formula
N ¼ 1 · 2(Ct GAPDH – Ct target).
Zebrafish maintenance and preparation of eggs
TAB zebrafish were reared and maintained on a light ⁄...
Báo cáo khoa học: NMR and molecular dynamics studies of an autoimmune myelin basic protein peptide and its antagonist Structural implications for the MHC II (I-Au)–peptide complex from docking calculations ppt
... Ala81 far distant
from the side chain of Arg78. The side chain of Arg78 is less
well defined, as in the case of aqueous solution, because of
the absence of interactions with the s ide chains of ... structural
importance of the nature o f the amino acid at position 81
of the encephalitogenic sequence 74–85 of guinea MBP:
replacement of Asp81 with an a...
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... monoclinic and orthorhombic forms
using the program align [7] gave an rmsd of 0.54 A
˚
between corresponding Ca atoms. The variation was
larger with respect to the C-domain, which gave an
rmsd of ... template
using Deep Vent DNA polymerase (New England Biolabs,
Ipswich, MA, USA), a sense primer (CATATGGCTAGC
ATGCGCATATTGCTGAGTAAC) containing an NheI site
and an antisense pri...
Tài liệu Báo cáo khoa học: "Syntactic and Semantic Kernels for Short Text Pair Categorization" docx
... divided the training (TREC) data in 9 bins of
increasing size (200 instances between two con-
tiguous bins) and we measured the learning and
test time
5
for each bin. Figure 5 shows that in
both the ... Roth,
2005). Each question is paired with all the top
20 answer paragraphs extracted by two basic QA
systems: one trained with the web documents and
the other trained...
Báo cáo khoa học: Sirt1 and mir-9 expression is regulated during glucose-stimulated insulin secretion in pancreatic b-islets ppt
... mechanisms
may help in the understanding and tackling of diseases
such as diabetes.
Experimental procedures
Animal experiments
Adult Swiss male mice were maintained at the Tata Insti-
tute of Fundamental ... Sirt1 and mir-9 expression is regulated during
glucose-stimulated insulin secretion in pancreatic b-islets
Deepti Ramachandran*, Upasana Roy*, Swati Garg, Sanchari Ghosh,...
Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf
... 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢
5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢
R11 4A 5¢-GAGAATTTCGAGCACGATACAGACTCCC-3¢
5¢-GGGAGTCTGTATCGTGCTCGAAATTCTC-3¢
Y116D 5¢-CGACGACGAGACAGACTCCCAGAACATGTC-3¢
5¢-GACATGTTCTGGGAGTCTGTCTCGTCGTCG-3¢
Y. ... Chaperones 8, 381–
394.
70 Rajaraman K, Raman B, Ramakrishna T & Rao CM
(2001) Interaction of human recombinant aA- and
aB-crystallins with early and late...
Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx
... FEBS
providing a rationale for the use of combinations of
MEK1 ⁄ 2 inhibitors and PI3K–PKB pathway inhibitors.
Indeed, rapamycin, an inhibitor of mammalian target of
rapamycin (mTOR) downstream of PKB, ... several signalling pathways, includ-
ing the ERK1 ⁄ 2 pathway, the PKB pathway and the
Janus kinase ⁄ signal transducer and activator of tran-
scription (JAK-S...
Báo cáo khoa học: "Extracting and modeling durations for habits and events from Twitter" doc
... durations is
crucial to any natural language processing task in-
volving temporal understanding and reasoning.
This information comes in many forms, among
them knowledge about typical durations ... durations has been com-
piled and made available. This automati-
cally generated duration information is
broadly comparable to hand-annotation.
1 Introduction
Implicit information about...
Báo cáo khoa học: "Local and Global Algorithms for Disambiguation to Wikipedia" pot
... Training
We train the coefficients for the ranker features us-
ing a linear Ranking Support Vector Machine, using
training data gathered from Wikipedia. Wikipedia
links are considered gold-standard ... gold-standard links for the
training process. The methods for compiling the
Wikipedia training corpus are given in Section 5.
We train the linker as a separate linear Sup...