... (B ¼ b-Rha, A ¼ a- Rha, A ¼ a- Fuc3NAc (1fi2) a- Rha) B A, B– A B A A, B A A, B A A, B A A B A A A, B A A A, B A A A, B A A A, B A A A, B– A A A, B A A A, B A A A Several of these combinations were ... NMR and MS evidences for a random assembled O-specific chain structure in the LPS of the bacterium Xanthomonas campestris pv. Vitians A...
Ngày tải lên: 31/03/2014, 09:20
... highly variable C-terminal domain after the terminal conserved arginine of the cytoplasmic serine ⁄ threonine kinase domain. Sequences for phylogenetic rela- tionships of the extracellular part were ... housekeeping gene by using the formula N ¼ 1 · 2(Ct GAPDH – Ct target). Zebrafish maintenance and preparation of eggs TAB zebrafish were reared and maintained on a light ⁄...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: NMR and molecular dynamics studies of an autoimmune myelin basic protein peptide and its antagonist Structural implications for the MHC II (I-Au)–peptide complex from docking calculations ppt
... Ala81 far distant from the side chain of Arg78. The side chain of Arg78 is less well defined, as in the case of aqueous solution, because of the absence of interactions with the s ide chains of ... structural importance of the nature o f the amino acid at position 81 of the encephalitogenic sequence 74–85 of guinea MBP: replacement of Asp81 with an a...
Ngày tải lên: 07/03/2014, 16:20
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... monoclinic and orthorhombic forms using the program align [7] gave an rmsd of 0.54 A ˚ between corresponding Ca atoms. The variation was larger with respect to the C-domain, which gave an rmsd of ... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense pri...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: "Syntactic and Semantic Kernels for Short Text Pair Categorization" docx
... divided the training (TREC) data in 9 bins of increasing size (200 instances between two con- tiguous bins) and we measured the learning and test time 5 for each bin. Figure 5 shows that in both the ... Roth, 2005). Each question is paired with all the top 20 answer paragraphs extracted by two basic QA systems: one trained with the web documents and the other trained...
Ngày tải lên: 22/02/2014, 02:20
Báo cáo khoa học: Sirt1 and mir-9 expression is regulated during glucose-stimulated insulin secretion in pancreatic b-islets ppt
... mechanisms may help in the understanding and tackling of diseases such as diabetes. Experimental procedures Animal experiments Adult Swiss male mice were maintained at the Tata Insti- tute of Fundamental ... Sirt1 and mir-9 expression is regulated during glucose-stimulated insulin secretion in pancreatic b-islets Deepti Ramachandran*, Upasana Roy*, Swati Garg, Sanchari Ghosh,...
Ngày tải lên: 06/03/2014, 00:21
Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf
... 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢ 5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢ R11 4A 5¢-GAGAATTTCGAGCACGATACAGACTCCC-3¢ 5¢-GGGAGTCTGTATCGTGCTCGAAATTCTC-3¢ Y116D 5¢-CGACGACGAGACAGACTCCCAGAACATGTC-3¢ 5¢-GACATGTTCTGGGAGTCTGTCTCGTCGTCG-3¢ Y. ... Chaperones 8, 381– 394. 70 Rajaraman K, Raman B, Ramakrishna T & Rao CM (2001) Interaction of human recombinant aA- and aB-crystallins with early and late...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx
... FEBS providing a rationale for the use of combinations of MEK1 ⁄ 2 inhibitors and PI3K–PKB pathway inhibitors. Indeed, rapamycin, an inhibitor of mammalian target of rapamycin (mTOR) downstream of PKB, ... several signalling pathways, includ- ing the ERK1 ⁄ 2 pathway, the PKB pathway and the Janus kinase ⁄ signal transducer and activator of tran- scription (JAK-S...
Ngày tải lên: 16/03/2014, 00:20
Báo cáo khoa học: "Extracting and modeling durations for habits and events from Twitter" doc
... durations is crucial to any natural language processing task in- volving temporal understanding and reasoning. This information comes in many forms, among them knowledge about typical durations ... durations has been com- piled and made available. This automati- cally generated duration information is broadly comparable to hand-annotation. 1 Introduction Implicit information about...
Ngày tải lên: 16/03/2014, 20:20
Báo cáo khoa học: "Local and Global Algorithms for Disambiguation to Wikipedia" pot
... Training We train the coefficients for the ranker features us- ing a linear Ranking Support Vector Machine, using training data gathered from Wikipedia. Wikipedia links are considered gold-standard ... gold-standard links for the training process. The methods for compiling the Wikipedia training corpus are given in Section 5. We train the linker as a separate linear Sup...
Ngày tải lên: 17/03/2014, 00:20