Báo cáo khoa học: A structural basis for the pH-dependence of cofilin F-actin interactions potx

... A structural basis for the pH-dependence of cofilin F-actin interactions Laurence Blondin 1 , Vasilia Sapountzi 2 , Sutherland K. Maciver 1 , Emeline Lagarrigue 2 , Yves Benyamin 1 and Claude ... by human ADF, but not of Acanthamoeba actophorin. Biochemistry 256, 388–397. 18. Iida, K., Moriyama, K., Matsumoto, S., Kawasaki, H., Nishida, E. & Yahara, I. (1993) Isolatio...

Ngày tải lên: 31/03/2014, 09:20

... rules—allow derivations to be partially associative: given appro- priate type assignments, a string ABC can be ana- lyzed as either A( BC) or (AB)C. This associativity leads to elegant analyses of phenomena ... derived as follows (✷ ↓ ant and ♦ ant are abbreviated as ✷ ↓ and ♦): 6 Note that the diamond operator used here is a syntactic op- erator, rather than a semantic operator as...

Ngày tải lên: 31/03/2014, 00:20

... natural or artificial languages. While an automatic formula finder may eventually serve as an important aid for research in automatic language translation, such a system cannot replace the ... the symbolic names for the predicates. Information enabling the automatic specifi- cation of each of these variables is present in the form of grammatical codes in the entr...

Ngày tải lên: 16/03/2014, 19:20

... 257 P554 GGCACTCGAACAGTCATATTG Exon 4 FDXR P557 ATTAAGGAGCTTCGGGAGATG Exon 7 380 P558 CTCTTATACCCAATGCTGCTG Exon 10 CYP1 1A First pair P561 GCCTTTGAGTCCATCACTAAC Exon 4 628 P562 CCAGTGTCTTGGCAGGAATC Exon ... Hospital Oakland Research Institute, Oakland, CA, USA for performing G C/MS an alyses, and Pr ofessor Walter Miller, U niversity o f C alifornia, San Francisco for the gift of N-...

Ngày tải lên: 23/03/2014, 13:20

... Voting. Recall that neither the raw data nor the collected feedback sets are manually annotated for training purposes. Since, in addition, the feedback sets are collected automatically, they are very ... Nonliteral precision and recall are de- fined similarly. Average precision is the average of literal and nonliteral precision; similarly for av- erage recall. For overall perfo...

Ngày tải lên: 24/03/2014, 03:20

... processivity. Materials and methods All mathematical analysis and numerical fitting were per- formed using the software package Mathematica 7.0 (Wol- fram Research, Inc. Champaign, IL, USA). The substrate ... supports the cur- rent explanation of the double exponential slowdown. In the last section, we show two examples of how the analysis of the kinetic parameters may eluc...

Ngày tải lên: 28/03/2014, 23:20

... measure is the Bhattacharyya coefficient, we can de- rive an analytical form that allows efficient calculation. For the task of word similar- ity estimation using a large amount of Web data in Japanese, ... are Dirich- let, and the base similarity measure is the Bhat- tacharyya coefficient (Bhattacharyya, 1943), we can derive an analytical form for Eq. 2, that en- ables efficien...

Ngày tải lên: 30/03/2014, 21:20

... Japan yotaro-w@ecei.tohoku.ac.jp Masayuki Asahara Yuji Matsumoto Graduate School of Information Science Nara Institute of Science and Technology 8916-5 Takayama, Ikoma, Nara, 630-0192, Japan {masayu -a, matsu}@is.naist.jp Abstract In ... Roles and Predicate Senses Yotaro Watanabe Graduate School of Information Sciences Tohoku University 6-6-05, Aramaki Aza Aoba, Aoba-ku, Sendai 980-8579...

Ngày tải lên: 30/03/2014, 21:20

... University of Western Australia, Crawley, Australia 2 Department of Pharmaceutical Sciences, College of Pharmacy, University of Tennessee Health Science Center, Memphis, TN, USA 3 Department of Pharmacognosy ... tissues such as the adre- nal gland may receive vitamin D from the bloodstream for further metabolism [4]. In conclusion, the identification of new metabolites of...

Ngày tải lên: 18/02/2014, 17:20

... of matrix sparse- ness can be minimized by reducing the dimension- ality of the matrix. An appropriate algebraic method that has the capability to reduce the dimen- sionality of a rectangular ... problem can be avoided since the contextual behavior of the senses is directly observable in the form of the local contexts of a word. From human disambiguation per...

Ngày tải lên: 20/02/2014, 16:20