Báo cáo khoa học: Swollenin, a Trichoderma reesei protein with sequence similarity to the plant expansins, exhibits disruption activity on cellulosic materials pptx

... sequence similarity to the plant expansins, exhibits disruption activity on cellulosic materials Markku Saloheimo 1 , Marja Paloheimo 1 , Satu Hakola 1 , Jaakko Pere 1 , Barbara Swanson 2 , Eini ... of the enzyme to the insoluble substrate. In addition to plants, a protein with an endoglucanase domain and a domain with sequence similarity to exp...

Ngày tải lên: 31/03/2014, 09:20

... imperfect. The question then arose as to whether it would be better to treat these variables as binary or con- tinuous. Theoretical justifications for a binary pa- rameterisation lie in the fact that a ... computational models, leading current re- searchers to continue to use the classic semantic and grammatical variables, enhancing them with NLP techniques. Because this re...

Ngày tải lên: 08/03/2014, 21:20

Ngày tải lên: 09/03/2014, 01:20

... antimicrobial assay and in planta studies demonstrated that NtKTI1 is an antifungal protein that increases the resistance of tobacco to fungal attack. Results Isolation and characterization of a cDNA encod- ing ... Planta 183, 528–535. 27 Yamagata H, Kunimatsu K, Kamasaka H, Kuramoto T & Iwasaki T (1998) Rice biofunctional alpha-amy- lase ⁄ subtilisin inhibitor: characterization,...

Ngày tải lên: 23/03/2014, 03:20

... Introduction Supertagging is based on the combination of two powerful and influential ideas of natural language processing: On the one hand, parsing is (at least partially) reduced to a decision on the ... important) constraints is always preferred. All knowledge about grammatical rules is encoded in the constraints that (together with the lexicon) constitute the gramma...

Ngày tải lên: 23/03/2014, 18:20

... Model-Refinement to adjust this so-called bias. The basic idea is to take advantage of misclassified examples in the training data to iteratively refine and adjust the centroids of text data. The experimental ... such as Naïve Bayes (Sebastiani 2002), can then be applied to learn each of these L problems. L can then be thought of as the length of the codewords 81 1...

Ngày tải lên: 20/02/2014, 12:20

... the parser’s syntactic constituents into logical grammatical relations (GLARF), and then extracted the 5Ws from the logical form. As a back-up, it also extracted GLARF relations from another ... where evaluation is done on translated results in the target language. In cross-lingual information extraction (Sudo et al. 2004) the evaluation is also done on MT, but the go...

Ngày tải lên: 08/03/2014, 00:20

... automated in- put to a data base. The long-term goal of the work described is to develop a support technology for spe- cific analytical functions related to the evaluation of daily message traffic ... UNDERSTANDING PROCESS The formal definition of the sublanguage currently takes the form of an ATN grammar. The parser takes a sentence as input and produces a p...

Ngày tải lên: 08/03/2014, 18:20

... 263 not select at all, or not as fast, for one desired microbial property as an auxostat. In contrast to nat- ural habitats, an auxostat provides a monoculture with a constant selection parameter, i.e. ... simulation started with the assumption that the yeast popula- tion contained cells with a variety of maximum growth rates, all normally distributed around the measured a...

Ngày tải lên: 16/03/2014, 04:20

... (5¢-AAA CCGCGGCAATGAAAAAG TTATTAGTCAAGGAG) and SH3 (5¢-AAA GGATCC GGTCTGCTACTAACACTAGGATTCATC). The PCR fragments were cut with SacII and BamHI and cloned into pGP172 linearized with the same enzymes. The ... lLmixturewastransferredtoafreshreactiontubeandthereaction was stopped (96 °C, 4 min). The fractions were then separated on a native polyacrylamide gel, analyzed using th...

Ngày tải lên: 16/03/2014, 16:20