Báo cáo khoa học: Purification, characterization and biosynthesis of parabutoxin 3, a component of Parabuthus transvaalicus venom pptx
Báo cáo khoa học: Purification, characterization and biosynthesis of parabutoxin 3, a component of Parabuthus transvaalicus venom pptx
... C-terminal arginine, was designed as follows (Fig. 3A) . Two overlapping oligonucleotide pairs 5¢-GAGGTCGACATGCGCTGCA AGTCGTCGAAGGAGTGCCTGGTCAAGTGCAAG CAG-3¢,3¢-CTCCAGCTGTACGCGACGTTCAGCAG CTTCCTCACGGACCAGTTCACGTTCGTCCGCTG CCCGGCC-5¢ ,and5 ¢-GCGACGGGCCGGCCGAACG GCAAGTGCATGAACCGGAAGTGCAAGTGCTAC CCGTGAG-3¢,3¢-GGCTTGCCGTTCACGTACTTGGC CTTCACGTTCACGATGGGCACTCCTAG-5¢,respect- ively, ... 5¢-GAGGTCGAC...
Ngày tải lên: 31/03/2014, 09:20
Báo cáo khoa học: Purification, characterization and molecular cloning of tyrosinase from the cephalopod mollusk, Illex argentinus docx
... proenzyme of phenol oxidase A 1 of Drosophila melanogaster. Proc. Natl Acad. Sci. USA 92, 7769–7773. 13. Kawabata, T., Yasuhara, Y., Ochiai, M., Matsuura, S. & Ashida, M. (1995) Molecular cloning of ... bp of the 5¢ untranslated regions and the 3¢ untranslated regions containing polyadenylation signals (AATAAA) at three positions and the poly (A) -tails. The criteria for a...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo khoa học: Purification, characterization, cDNA cloning and nucleotide sequencing of a cellulase from the yellow-spotted longicorn beetle, Psacothea hilaris ppt
... cello-oligosaccha- ride was prepared by the method of Sawano et al. [10], and the average degree of polymerization was 34. To test the degradation activity of P. hilaris cellulase against crystalline cellulose, ... Horiba, Kyoto, Japan). Enzyme assay A carboxymethylcellulase (CMCase) assay was performed by measuring the amount of reducing sugars after incuba- tion of 100 lL 1%...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo khoa học: Purification, microsequencing and cloning of spinach ATP-dependent phosphofructokinase link sequence and function for the plant enzyme pdf
... Degenerate oligonucleotide pairs (5¢-GARATYTAYTTYGARCCT-3¢⁄5¢-WCCVARA ACAGCRTTTCC-3¢, SoPFK1; and 5¢-ACHATYGAY AAYGATATT-3¢⁄5¢-RTABGTDGGTRCTATGTA-3¢, So- PFK2) were incubated with 10 ng of cDNA substrate ... glycerol-3-phosphate dehydrogenase and 1 U of aldolase [49,50] in a final assay volume of 200 lL (GENios Microplate Reader; Tecan Instruments, Crailsheim, Germany). The reactio...
Ngày tải lên: 07/03/2014, 11:20
Báo cáo khoa học: Identification, characterization and activation mechanism of a tyrosine kinase of Bacillus anthracis docx
... as Walker A, A and B, with some exceptions [4]. The majority of the bacterial tyrosine kinases possess a transmembrane domain and an intracellular catalytic domain [3,4 ]. These two domains are ... proteins also lack tyrosine kinase activity. However, the blast search of McsB and its activator McsA in the B. anthracis database revealed two orthologs, BAS0080 (81% similarity) an...
Ngày tải lên: 23/03/2014, 06:20
Báo cáo Y học: Purification, characterization and subunits identification of the diol dehydratase of Lactobacillus collinoides pot
... Purification, characterization and subunits identification of the diol dehydratase of Lactobacillus collinoides Nicolas Sauvageot 1 , Vianney Pichereau 1 , Loı¨c Louarme 2 , Axel Hartke 1 , Yanick ... decreased reflecting the increased fixation of the inactive analogue of the AdoCbl. A K i of 26.4 l M was calculated for the cyanocobalamin. For all the dehydratases characterized...
Ngày tải lên: 23/03/2014, 21:20
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx
... 275–283. 10 Kuwada M, Teramoto T, Kumagaye KY, Nakajima K, Watanabe T, Kawai T, Kawakami Y, Niidome T, Sawada K, Nishizawa Y et al. (1994) Omega-agatoxin- TK containing D-serine at position 46, but ... crosspeaks were assigned and inte- grated, with concomitant cycles of structure calcula- tions for evaluation of distance and angle constraint violations as well as assignments of add...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: Purification and characterization of glutamate N-acetyltransferase involved in citrulline accumulation in wild watermelon doc
... primers; CLGAT 5a (5¢-GGCATCAACAT- CACAAGCAACAAGTGCAAG-3¢), CLGAT5b (5¢-TCCT- CCATCAATCTGCTTCCATGGACCATC-3¢), CLGAT 3a (5¢-GCTGTGGCTACGAATGAGGCCGCC-3) and CLGAT3b (5¢-AAGGGAGAGAAACCTGACCTTGCACTTG-3¢). ... watermelon Kentaro Takahara, Kinya Akashi and Akiho Yokota Graduate School of Biological Sciences, Nara Institute of Science and Technology, Japan Drought in the presence of st...
Ngày tải lên: 20/02/2014, 03:20
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf
... Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii Maghil Denis, P. D. Mercy Palatty, N. Renuka Bai and S. Jeya Suriya Department ... Denmark. 47. Kamiya, H. & Ogata, K. (1982) Hemagglutinins in the acorn barnacle Balanus (Megabalanus roseus): purification and char- acterization. Nippon Suisan G...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf
... of AF499 was identified as an archaeal promoter element by seque nce analysis. The sequ ence AAAGGTTAATATA shows a high le vel of identity with th e consensus se quence ()35 to ) 23, AAANNN TTATATA) ... with an apparent molecular mass of 53 kDa appears as a double band in unboiled samples (lanes A1 and B1). Table 1. N-Terminal sequences of the polypeptides of the purified enzy...
Ngày tải lên: 21/02/2014, 03:20