Báo cáo khoa học: Structure–activity relation for synthetic phenoxazone drugs Evidence for a direct correlation between DNA binding and pro-apoptotic activity pdf

Báo cáo khoa học: Structure–activity relation for synthetic phenoxazone drugs Evidence for a direct correlation between DNA binding and pro-apoptotic activity pdf

Báo cáo khoa học: Structure–activity relation for synthetic phenoxazone drugs Evidence for a direct correlation between DNA binding and pro-apoptotic activity pdf

... Structure activity relation for synthetic phenoxazone drugs Evidence for a direct correlation between DNA binding and pro-apoptotic activity Alexei N. Veselkov 1 , Vladimir Ya. Maleev 2 , ... width at half height) of the heat absorption curve. All values of thermodynamic parameters were calculated for 1 mol base pairs, taking an average molecular mass of...

Ngày tải lên: 31/03/2014, 07:20

8 331 0
Tài liệu Báo cáo khoa học: Structure-activity relationships of a-conotoxins targeting neuronal nicotinic acetylcholine receptors ppt

Tài liệu Báo cáo khoa học: Structure-activity relationships of a-conotoxins targeting neuronal nicotinic acetylcholine receptors ppt

... of an arginine residue at position 12 (Table 1) appears to contribute to a4 b2anda7 subtype activity but not a3 b2 activity. A decrease in a4 b2 and a7 subtype activity but not a3 b2 activity was ... Mutational analyses have also been valuable in elucidating factors important for activity. Table 2 lists the most informative mutations that have been made in a range of a-...

Ngày tải lên: 19/02/2014, 12:20

7 493 0
Báo cáo khoa học: Structure–activity relationships of fowlicidin-1, a cathelicidin antimicrobial peptide in chicken docx

Báo cáo khoa học: Structure–activity relationships of fowlicidin-1, a cathelicidin antimicrobial peptide in chicken docx

... that retains the antibacterial potency but which has substantially reduced cytotoxicity. Such a peptide analog may rep- resent an excellent candidate as a novel antimicrobial agent against bacteria ... fowlicidin-1 and its analogs Two representative Gram-negative bacteria (Escher- ichia coli ATCC 25922 and Salmonella enterica serovar Typhimurium ATCC 14028) and two Gram-positive bac...

Ngày tải lên: 30/03/2014, 11:20

13 386 0
Báo cáo khoa học: Structure of Streptococcus agalactiae serine⁄threonine phosphatase The subdomain conformation is coupled to the binding of a third metal ion pptx

Báo cáo khoa học: Structure of Streptococcus agalactiae serine⁄threonine phosphatase The subdomain conformation is coupled to the binding of a third metal ion pptx

... described here and is present in the S. agalactiae PPase, kinase and adenylosuccinate syn- thase, but not in S. agalactiae CovR ⁄ CsrR. The motif is located at the surface of the SaPPase (Rantanen, unpublished), ... mechanisms in Streptococcus agalactiae. Mol Microbiol 62, 941–957. 23 Rantanen MK, Lehtio ¨ L, Rajagopal L, Rubens CE & Goldman A (2006) Crystallization and preliminar...

Ngày tải lên: 07/03/2014, 09:20

10 543 0
Báo cáo khoa học: D88A mutant of cytochrome P450nor provides kinetic evidence for direct complex formation with electron donor NADH ppt

Báo cáo khoa học: D88A mutant of cytochrome P450nor provides kinetic evidence for direct complex formation with electron donor NADH ppt

... the mutant proteins were as follows (mutated sites are under- lined): D8 8A, 5¢-ACATTTGTC GCCATGGATCC-3¢; D88V, 5¢-GCCGACATTTGTC GTCATGGATCC-3¢; D88N, 5¢-GCCGACATTTGTC AACATGGATCC-3¢; and D39 3A, 5¢-CTGAACCGA GCTGTCGGAAT-3¢. The ... in absorbance (DA) at 413 nm from that at 395 nm caused by Cl – binding. Analytical methods The Nor activity of P450nor was assayed as reported [4]. P450nor...

Ngày tải lên: 07/03/2014, 15:20

8 405 0
Báo cáo khoa học: Alizarine derivatives as new dual inhibitors of the HIV-1 reverse transcriptase-associated DNA polymerase and RNase H activities effective also on the RNase H activity of non-nucleoside resistant reverse transcriptases pot

Báo cáo khoa học: Alizarine derivatives as new dual inhibitors of the HIV-1 reverse transcriptase-associated DNA polymerase and RNase H activities effective also on the RNase H activity of non-nucleoside resistant reverse transcriptases pot

... FEBS Asp110 Asp185 Asp186 Trp229 Tyr181 NNRTIbp E Tyr188 Asp110 Asp185 Asp186 Trp229 Cys181 NNRTIbp B Asp110 Asp185 Asp186 Trp229 Tyr181 NNRTIbp Tyr188 F Asp110 Asp185 Asp186 Trp229 Cys181 NNRTIbp C Asp110 Asp185 Asp186 Trp229 Tyr181 Tyr188 NNRTIbp G Tyr188 Tyr181 Trp229 Asn103 D Asp110 Asp185 Asp186 Trp229 Tyr181 Tyr188 NNRTIbp H Asp110 Asp185 Asp186 Trp229 Cys181 NNRTIbp A K126 K126 I Asp...

Ngày tải lên: 22/03/2014, 16:20

14 425 0
Báo cáo khoa học: The activity of Plasmodium falciparum arginase is mediated by a novel inter-monomer salt-bridge between Glu295–Arg404 doc

Báo cáo khoa học: The activity of Plasmodium falciparum arginase is mediated by a novel inter-monomer salt-bridge between Glu295–Arg404 doc

... bacterial and mammalian templates. P. falciparum Glu295 aligns with an Asp in mam- mals (human arginase II: Asp223; rat arginase I: Asp204), fungi and bacteria (B. caldovelox arginase: Asp199). ... indicated that P. falciparum arginase has a strong depen- dency between trimer formation, enzyme activity and metal co-ordination. Mutations that abolished Mn 2+ binding also caused d...

Ngày tải lên: 29/03/2014, 23:20

14 426 0
Báo cáo khóa học: UDP-galactose 4-epimerase from Kluyveromyces fragilis Evidence for independent mutarotation site pdf

Báo cáo khóa học: UDP-galactose 4-epimerase from Kluyveromyces fragilis Evidence for independent mutarotation site pdf

... re-activation rate was observed in all cases. Relative re-activation rates and maximum recoveries were as follows: 1.1 and 82% for yeast mutarotase, 3.2 and 88% for epimerase, and 6.8 and 91% for capsicum ... optima of mutarotase from both kidney cortex and capsicum are broad, with maxima at % 7.4, and activity at pH 4.0 and 8.0 was 70–72%. For yeast mutarotase, the...

Ngày tải lên: 30/03/2014, 13:20

11 362 0
Báo cáo khoa học: K182G substitution in DevR or C8G mutation in the Dev box impairs protein–DNA interaction and abrogates DevR-mediated gene induction in Mycobacterium tuberculosis doc

Báo cáo khoa học: K182G substitution in DevR or C8G mutation in the Dev box impairs protein–DNA interaction and abrogates DevR-mediated gene induction in Mycobacterium tuberculosis doc

... CGACACGTAGTT CGCCACCGTCTTTTC fdxA-C8G f TGACGAATAAGGC GTTTGGTCCTTTCC fdxA-C8G r GGAAAGGACCAAA CGCCTTATTCGTCA fdxA -A9 T f TGACGAATAAGGCC ATTGGTCCTTTCC fdxA -A9 T r GGAAAGGACCAA TGGCCTTATTCGTCA fdxA-C8G -A9 T f TGACGAATAAGGC GATTGGTCCTTTCC fdxA-C8G -A9 T ... TGACGGGCTATCGTAAGTTTATG fdxA r CACGCACTCACTACCGATCACA K182G f GAAAAGACGGTG GGGAACTACGTGTCG K182G r CGACACGTAGTT CCCCACCGTCTTTTC K18 2A f...

Ngày tải lên: 22/03/2014, 16:20

9 351 0
Tài liệu Báo cáo khoa học: Endotoxic activity and chemical structure of lipopolysaccharides from Chlamydia trachomatis serotypes E and L2 and Chlamydophila psittaci 6BC pdf

Tài liệu Báo cáo khoa học: Endotoxic activity and chemical structure of lipopolysaccharides from Chlamydia trachomatis serotypes E and L2 and Chlamydophila psittaci 6BC pdf

... times. Analytical HPAEC The deacylated LPS was analysed by analytical high- performance anion exchange chromatography (HPAEC) on a column of CarboPak PA1 (4 mm · 250 mm, Dionex) using the eluents (A) ... metallic sample holder, dried in a stream of air and analyzed immediately after evaporation. The spectra are the sum of at least 50 single laser shot experiments. External mass scale ca...

Ngày tải lên: 20/02/2014, 23:20

11 560 0
w