Báo cáo khoa học: Plasmoredoxin, a novel redox-active protein unique for malarial parasites doc

... PRIORITY PAPER Plasmoredoxin, a novel redox-active protein unique for malarial parasites Katja Becker 1 , Stefan M. Kanzok 2 , Rimma Iozef 1 , Marina Fischer 1 , R. Heiner Schirmer 2 and Stefan Rahlfs 1 1 Interdisciplinary ... malaria; Plasmodium falciparum; redox-metabolism; thioredoxin superfamily. The malarial parasite, Plasmodium falciparum is respon- sible for more...

Ngày tải lên: 31/03/2014, 07:20

... antisense AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses Kristiina A. Vuori 1 , Johanna K. Ahlskog 2 , Lea Sis...

Ngày tải lên: 18/02/2014, 14:20

... Generation Kiyoaki Shirai Hiroshi Ookawa Japan Advanced Institute of Science and Technology 1-1, Asahidai, Nomi, 923-1292, Ishikawa, Japan {kshirai,h-ookawa}@jaist.ac.jp Abstract This paper describes a system ... e t al., 2003). Especially, several researchers have proposed animation generation systems in the cooking domain. Karlin, for exam- ple, developed SEAFACT (Semantic Analysis For...

Ngày tải lên: 31/03/2014, 01:20

... 5¢-GGGAATTCCATATGAGAGACAATA TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,and PDE1(Lys321–Thr620) was amplified with primers 5¢-GGG AATTCCATATGAAGAATGATCAATCTGGCTGCG GCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGG TTCCCTGTCCAGTGTTACC-3¢. ... African trypanosome Trypanosoma brucei is the protozoon that causes the fatal human sleeping sickness, as well as Nagana, a devastating...

Ngày tải lên: 19/02/2014, 12:20

... show vast differences in p reference f or insect and mammalian Na + channels. Accordingly, they are divided into classical a- toxins that are highly active in mammalian brain, a- toxins that are ... eneral de Asuntos del Personal Acad- emico (DGAPA), UNAM to L.D.P. The authors are grateful to Dr Martin S. Williamson, IACR- Rothamsted, UK, for sharing the para and tipE clone; C. Maertens a...

Ngày tải lên: 07/03/2014, 16:20

... Katoh, Hideki Shibata and Masatoshi Maki Department of Applied Molecular Biosciences, Graduate School of Bioagricultural Sciences, Nagoya University, Japan Alix (also named AIP1) is an interacting ... reated by PCR-based site-directed mutagenesis using pmGFP–Brox as a template and complementary primers (5¢-CAA AAG GAC ACT GGG TCC TAC ATC TCC TAA G-3¢ and 5¢-CTT AGG AGA TGT AGG ACC CAG TGT C...

Ngày tải lên: 16/03/2014, 06:20

... messages in microblogs. Our system can be regarded as a sentiment-driven, music-based sum- marization framework as well as a novel audiovis- ual presentation of art. MemeTube is designed as a ... We also integrate the sentiment-detection system with a real-time rule-based harmonic music and animation generator to display streams of messages in an audiovisual format.  Conceptua...

Ngày tải lên: 20/02/2014, 05:20

... text spans; for exam- ple, because, since, and for this reason are dif- ferent markers for causal relations. Discourse markers are a syntactically quite heterogeneous group of words, many ... found a cheap bar. If one accepts these sentences as paraphrases, then the various discourse markers all need to be associated with the information that they sig- nal a concessive...

Ngày tải lên: 20/02/2014, 18:20

... general, a particular semantic interpretation of a sentence can be characterized by a set of lexical categories (or parts of speech), a syntactic struc- ture, and the semantic annotations associated ... information. Hence, we will show how to annotate a syntax tree so that various interpretations can be characterized differently. Semantic Tagging A popular linguistic approach...

Ngày tải lên: 20/02/2014, 21:20

... length-based and integrates a shal- low content analysis. It begins by individuating a paragraph in the target text which is a first candi- date as target paragraph, and which we call "pivot". ... corpora are available, also the translation equivalents of the collocation context are displayed, thus allowing the user to see how a given collocation was translated in different...

Ngày tải lên: 22/02/2014, 02:20