Báo cáo khoa học: Plasmoredoxin, a novel redox-active protein unique for malarial parasites doc

Báo cáo khoa học: Plasmoredoxin, a novel redox-active protein unique for malarial parasites doc

Báo cáo khoa học: Plasmoredoxin, a novel redox-active protein unique for malarial parasites doc

... PRIORITY PAPER Plasmoredoxin, a novel redox-active protein unique for malarial parasites Katja Becker 1 , Stefan M. Kanzok 2 , Rimma Iozef 1 , Marina Fischer 1 , R. Heiner Schirmer 2 and Stefan Rahlfs 1 1 Interdisciplinary ... malaria; Plasmodium falciparum; redox-metabolism; thioredoxin superfamily. The malarial parasite, Plasmodium falciparum is respon- sible for more...

Ngày tải lên: 31/03/2014, 07:20

8 412 0
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... antisense AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses Kristiina A. Vuori 1 , Johanna K. Ahlskog 2 , Lea Sis...

Ngày tải lên: 18/02/2014, 14:20

9 457 0
Báo cáo khoa học: "Compiling a Lexicon of Cooking Actions for Animation Generation" doc

Báo cáo khoa học: "Compiling a Lexicon of Cooking Actions for Animation Generation" doc

... Generation Kiyoaki Shirai Hiroshi Ookawa Japan Advanced Institute of Science and Technology 1-1, Asahidai, Nomi, 923-1292, Ishikawa, Japan {kshirai,h-ookawa}@jaist.ac.jp Abstract This paper describes a system ... e t al., 2003). Especially, several researchers have proposed animation generation systems in the cooking domain. Karlin, for exam- ple, developed SEAFACT (Semantic Analysis For...

Ngày tải lên: 31/03/2014, 01:20

8 425 0
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

... 5¢-GGGAATTCCATATGAGAGACAATA TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,and PDE1(Lys321–Thr620) was amplified with primers 5¢-GGG AATTCCATATGAAGAATGATCAATCTGGCTGCG GCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGG TTCCCTGTCCAGTGTTACC-3¢. ... African trypanosome Trypanosoma brucei is the protozoon that causes the fatal human sleeping sickness, as well as Nagana, a devastating...

Ngày tải lên: 19/02/2014, 12:20

11 566 0
Báo cáo khoa học: Phaiodotoxin, a novel structural class of insect-toxin isolated from the venom of the Mexican scorpion Anuroctonus phaiodactylus pdf

Báo cáo khoa học: Phaiodotoxin, a novel structural class of insect-toxin isolated from the venom of the Mexican scorpion Anuroctonus phaiodactylus pdf

... show vast differences in p reference f or insect and mammalian Na + channels. Accordingly, they are divided into classical a- toxins that are highly active in mammalian brain, a- toxins that are ... eneral de Asuntos del Personal Acad- emico (DGAPA), UNAM to L.D.P. The authors are grateful to Dr Martin S. Williamson, IACR- Rothamsted, UK, for sharing the para and tipE clone; C. Maertens a...

Ngày tải lên: 07/03/2014, 16:20

9 534 0
Báo cáo khoa học: Brox, a novel farnesylated Bro1 domain-containing protein that associates with charged multivesicular body protein 4 (CHMP4) potx

Báo cáo khoa học: Brox, a novel farnesylated Bro1 domain-containing protein that associates with charged multivesicular body protein 4 (CHMP4) potx

... Katoh, Hideki Shibata and Masatoshi Maki Department of Applied Molecular Biosciences, Graduate School of Bioagricultural Sciences, Nagoya University, Japan Alix (also named AIP1) is an interacting ... reated by PCR-based site-directed mutagenesis using pmGFP–Brox as a template and complementary primers (5¢-CAA AAG GAC ACT GGG TCC TAC ATC TCC TAA G-3¢ and 5¢-CTT AGG AGA TGT AGG ACC CAG TGT C...

Ngày tải lên: 16/03/2014, 06:20

11 412 0
Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf

Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf

... messages in microblogs. Our system can be regarded as a sentiment-driven, music-based sum- marization framework as well as a novel audiovis- ual presentation of art. MemeTube is designed as a ... We also integrate the sentiment-detection system with a real-time rule-based harmonic music and animation generator to display streams of messages in an audiovisual format.  Conceptua...

Ngày tải lên: 20/02/2014, 05:20

6 449 0
Tài liệu Báo cáo khoa học: "DiMLex: A lexicon of discourse markers for text generation and understanding" docx

Tài liệu Báo cáo khoa học: "DiMLex: A lexicon of discourse markers for text generation and understanding" docx

... text spans; for exam- ple, because, since, and for this reason are dif- ferent markers for causal relations. Discourse markers are a syntactically quite heterogeneous group of words, many ... found a cheap bar. If one accepts these sentences as paraphrases, then the various discourse markers all need to be associated with the information that they sig- nal a concessive...

Ngày tải lên: 20/02/2014, 18:20

5 528 0
Tài liệu Báo cáo khoa học: "GPSM: A GENERALIZED PROBABILISTIC SEMANTIC MODEL FOR AMBIGUITY RESOLUTION" pptx

Tài liệu Báo cáo khoa học: "GPSM: A GENERALIZED PROBABILISTIC SEMANTIC MODEL FOR AMBIGUITY RESOLUTION" pptx

... general, a particular semantic interpretation of a sentence can be characterized by a set of lexical categories (or parts of speech), a syntactic struc- ture, and the semantic annotations associated ... information. Hence, we will show how to annotate a syntax tree so that various interpretations can be characterized differently. Semantic Tagging A popular linguistic approach...

Ngày tải lên: 20/02/2014, 21:20

8 412 0
Tài liệu Báo cáo khoa học: "Creating a Multilingual Collocation Dictionary from Large Text Corpora" docx

Tài liệu Báo cáo khoa học: "Creating a Multilingual Collocation Dictionary from Large Text Corpora" docx

... length-based and integrates a shal- low content analysis. It begins by individuating a paragraph in the target text which is a first candi- date as target paragraph, and which we call "pivot". ... corpora are available, also the translation equivalents of the collocation context are displayed, thus allowing the user to see how a given collocation was translated in different...

Ngày tải lên: 22/02/2014, 02:20

4 479 0
w