Báo cáo khoa học: Biotinylation in the hyperthermophile Aquifex aeolicus Isolation of a cross-linked BPL:BCCP complex pptx

... underlining and mutagenic changes are shown in bold). BPL-for, 5¢-TTCTTAA CCATGG GCTTCAAAAACCTGAT-CTGG-3¢;BPL-rev,5¢-TTAA GGATCCTAAGAACGAGACAGGCTGAACTCTCC-3¢; BCCPD67, 5¢-GTAA CCATGGGTGAACAGGAAGA A- 3¢;BCCP-rev,5¢- GGATCCTTAAACGTTTGTGTC TATAAG-3¢; ... BirA [19]. In E. coli, we have expressed active A. aeolicus BPL, the biotin-binding domain of A. aeolicus BCCP as a His 6 N-te...

Ngày tải lên: 31/03/2014, 07:20

... five stranded antiparallel b-sheet (strands bC–bG) facing the interior of the phage particle, with an N-terminal hairpin (strands bAandbB) and two a- helices (aAandaB) shielding most of the upper ... introduction of the beta branched side-chain where the unbranched Met side-chain is ordinarily packed. The physical basis for the reduced stability of the T45S mutant may...

Ngày tải lên: 19/02/2014, 12:20

... consists of the evaluation of a teachability predicate for the antecedent on which we will concentrate here, and of the evaluation of the predi- cate lsAnaphorFor which contains the linguistic and ... different kinds of anaphoric expres- sions, (pro)nominal anaphors and textual ellipses are marked by italics, and the (pro)nominal anaphors are un- derlined, in...

Ngày tải lên: 22/02/2014, 03:20

... alternation in the value of the voicing feature. The voicing feature of the set of verbs we are talking about is altered if the final segment of the coda is either a labial fricative ("v") ... syllables) is as before, but the definition of a syllable needs to take into account the fact that we are now dealing with lists of features and their val-...

Ngày tải lên: 09/03/2014, 01:20

... is a question. Indeed, a natural way to seek informa- tion is to pose questions in a natural-language form (“how many calories in a banana”). Present day web search queries, however, have largely ... that the decreasing gap in search quality (as measured by click positions) might have contributed to the in- crease in Q-level, if we examine the co-click data without th...

Ngày tải lên: 17/03/2014, 00:20

... with any atom containing the feature 'char = a& apos; and accept the values for 'case' and 'accent' found in these atoms. By feature-passing these values will then ... and it simply means that all typographical variants of a character are collapsed so that the dictionary will only have to contain one character type. A normalizing constructor for...

Ngày tải lên: 18/03/2014, 02:20

... pigmentosa, adRP), involving mainly point mutations and a few deletions. Mutations associ- ated with adRP are spread all over the opsin gene in the three domains of the receptor: intradiscal, TM and cytoplasmic. ... with the increase in size of the side-chain at position 51, pointing to a disruption of the interhelical packing due to the mutations. In the case...

Ngày tải lên: 22/03/2014, 16:20

... data suggest a strong structural role for the terminal part of the C-terminal domain of ALSV integrase in the general folding of the enzyme and, hence, in its activity in the concerted DNA integration ... ends of the viral DNA and filling in the gaps between target and viral DNAs, generating a duplication of target DNA. (B) In vitro assay. Representation...

Ngày tải lên: 23/03/2014, 15:21

Ngày tải lên: 29/03/2014, 08:20

... in the brain. (A) Staining for serine racemase in the cerebral cortex (Ctx) of a P7 rat (layers IV–VI). (B) Staining of neurons in the stratum pyramidale (Pyr) of the CA1 region of the hippocampus. ... distribution of d-serine in rat brain co-localized almost perfectly with that of NMDARs [33,34]. The density of d-serine is much lower in the caudal part...

Ngày tải lên: 30/03/2014, 04:20