Báo cáo khoa học: "GENERATING A SPECIFIC CLASS OF METAPHORS" pptx

Báo cáo khoa học: "GENERATING A SPECIFIC CLASS OF METAPHORS" pptx

Báo cáo khoa học: "GENERATING A SPECIFIC CLASS OF METAPHORS" pptx

... goal that the metaphor is to achieve. 4.1 General Approach The idea behind the approach is to identify re- lated domains of the tenor domain that are appro- priate as metaphorical domains. ... of metaphors that are prevalent in natural expressions and perhaps more amenable to compu- tational approaches. We call these transparently- motivated (T-M) metaphors (Jones and McCoy 1992)...

Ngày tải lên: 31/03/2014, 06:20

3 267 0
Tài liệu Báo cáo khoa học: "Towards a Computational Treatment of Superlatives" pptx

Tài liệu Báo cáo khoa học: "Towards a Computational Treatment of Superlatives" pptx

... that their sys- tem represents a powerful way of dealing with su- perlatives computationally, a closer inspection of their approach, and in particular of the gold stan- dard data set, reveals ... Elements of a Computational Treat- ment of Superlatives For an interpretation of comparisons, two things are generally of interest: What is being compared, and with respect to...

Ngày tải lên: 20/02/2014, 12:20

6 446 0
Báo cáo khoa học: "TOWARDS A NEW TYPE OF ANALYSE " pptx

Báo cáo khoa học: "TOWARDS A NEW TYPE OF ANALYSE " pptx

... project of man-machine cozununication without a pre-arranged data base (TIBAQ). The kind of morphemic analysis z~resented here is based on a retrograde (right-to-left) analysis of words by means ... to grammatical agreement, also with verbs and adjectives in the above mentioned way, and because in tech- nical texts substantially more masculine- -animate than feminine-animate...

Ngày tải lên: 09/03/2014, 01:20

8 414 0
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

... 5¢-GGGAATTCCATATGAGAGACAATA TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,and PDE1(Lys321–Thr620) was amplified with primers 5¢-GGG AATTCCATATGAAGAATGATCAATCTGGCTGCG GCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGG TTCCCTGTCCAGTGTTACC-3¢. ... of parasites as potential targets for antiparasitic drugs. The African trypanosome Trypanosoma brucei is the protozoon that causes the...

Ngày tải lên: 19/02/2014, 12:20

11 566 0
Báo cáo khoa học: "Generating a Table-of-Contents" pptx

Báo cáo khoa học: "Generating a Table-of-Contents" pptx

... Table -of- Contents S.R.K. Branavan, Pawan Deshpande and Regina Barzilay Massachusetts Institute of Technology {branavan, pawand, regina}@csail.mit.edu Abstract This paper presents a method for the auto- matic ... Most of these approaches are tailored to a par- 1 The code and feature vector data for our model and the baselines are available at http://people.csail.mit.edu/branavan/code...

Ngày tải lên: 17/03/2014, 04:20

8 353 0
Báo cáo khoa học: "Generating a Non-English Subjectivity Lexicon: Relations That Matter" ppt

Báo cáo khoa học: "Generating a Non-English Subjectivity Lexicon: Relations That Matter" ppt

... Lexicon: Relations That Matter Valentin Jijkoun and Katja Hofmann ISLA, University of Amsterdam Amsterdam, The Netherlands {jijkoun,k.hofmann}@uva.nl Abstract We describe a method for creating a non- English ... positive and negative seeds) in Table 4. To allow a fair comparison of the generated rankings, the evaluation measures in this case are calculated separately for two binary...

Ngày tải lên: 24/03/2014, 03:20

8 288 0
Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt

Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt

... 40760–40767. 34 Yamada H, Tada-Oikawa S, Uchida A & Kawanishi S (1999) TRAIL causes cleavage of bid by caspase-8 and loss of mitochondrial membrane potential resulting in apoptosis in BJAB cells. ... Shigeno M, Nako K, Ichikawa T, Suzuki K, Kawakami A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H, Hamasaki K et al. (2003) Interferon -a sensitizes human hepatoma cells to TRAIL-induce...

Ngày tải lên: 19/02/2014, 06:20

11 679 0
Tài liệu Báo cáo khoa học: "Generating Fine-Grained Reviews of Songs From Album Reviews" doc

Tài liệu Báo cáo khoa học: "Generating Fine-Grained Reviews of Songs From Album Reviews" doc

... was annotated for song titles and song features. Feature annotation consists of marking a phrase as a feature and matching it with the song to which the feature is attributed. Note that we have ... paragraph in the final summary. However, fea- tures domains that are considered as sub-domains of another domain are included in the same para- graph, but are ordered next to the features o...

Ngày tải lên: 20/02/2014, 04:20

10 402 0
Tài liệu Báo cáo khoa học: "Generating research websites using summarisation techniques" pptx

Tài liệu Báo cáo khoa học: "Generating research websites using summarisation techniques" pptx

... techniques Advaith Siddharthan & Ann Copestake Natural Language and Information Processing Group Computer Laboratory, University of Cambridge {as372,aac10}@cl.cam.ac.uk Abstract We describe an application ... that also maintain a web page. In this framework, information easily gets outdated, and publications lists generally stay more up-to-date than research summaries. Also, as indivi...

Ngày tải lên: 20/02/2014, 09:20

4 338 0
Tài liệu Báo cáo khoa học: "MATCHKiosk: A Multimodal Interactive City Guide" pptx

Tài liệu Báo cáo khoa học: "MATCHKiosk: A Multimodal Interactive City Guide" pptx

... restaurants in Alexandria, a multimodal combination of speech and pen, e.g. moderate italian restaurants in this area and circling Alexandria on the map, or solely pen, e.g. user writes moderate ... keyboard, but these can be awkward to use and occupy a considerable amount of screen real estate, generally leading to a more moded and cumbersome graphical interface. A number of ex...

Ngày tải lên: 20/02/2014, 16:20

4 334 0
Từ khóa:
w