Báo cáo khoa học: "Deep Read: A Reading Comprehension System" pdf

... Abstract This paper describes initial work on Deep Read, an automated reading comprehension system that accepts arbitrary text input (a story) and answers questions about it. We have acquired ... "graduate" to real-world applications. Reading comprehension tests can serve as a testbed, providing an impetus for research in a number of areas: • Machine learning o...

Ngày tải lên: 31/03/2014, 04:20

... project in the world that applies (iii) not only as a matter of principle but as actual practice. We will regard a natural language as a set of texts. A translation pair is a pair of texts (T~, ... subtree, dominated by the nonterminal node A, and (ii) t is a tree, dominated by A& apos;, and (iii) A& apos; is a copy of A& apos;, and (iv) the immediate daughters of...

Ngày tải lên: 08/03/2014, 18:20

... TCATCTTTTAAACTTTGGGCGAAGGCGTTT 23 TTTTCTCGAGAAAGATGCCGATTTGGGCGC 24 GGGGCTCGAGGTTTTATATTTGTTGTAAAA 25 ATATTATATATATATATAGGGTCGTATATA 26 AAATTATAGAAAGCAGTAGA TAAAACAATG 27 CTTCGAAGAATATACTAAAAAATGAGCAGG CAAGATAAACGAAGGCAAAGTTCAATTCA TCATTTTTTTTTTATTCTTTT 28 ... GCCCGGATCCTGATAGTAATAGAATCCAAA 4 CCCCGAATTCAAATTATAGAAAGCAGTAGA 5 AAGGCTCGAGAGATCTGTTTAGCTTGCCTC 6 AAAAGTCGACGAGCTCGTTTTCGACACTGG 7 TT...

Ngày tải lên: 16/03/2014, 01:20

... may require special crmputational treatment and that therefore a relatively shallow analysis of the text may be sufficient for automatic translation of the sublanguage. This hypothesis and ... particular sublanguage defined by our corpus, ac- ceptable translation does not necessarily depend on standard linguistic structural analysis but can be obtained with a relatively shallow an...

Ngày tải lên: 17/03/2014, 19:21

... class of term variants, not for each term variant separately. Table 1: Automatic term normalization Term variants Normalised term human cancers cancer in humans human’s cancer human ... morphological, syntactic, lexico-semantic and pragmatic phenomena. Our approach to term variation management is based on term normali- zation as an integral part of the ATR process. Term variants...

Ngày tải lên: 31/03/2014, 01:20

... Machine Translation system is a software designed that essentially takes a text in one language (called the source language), and translates it into another language (called the target language). ... places, objects etc. that cannot be found in translation resources such as Hindi-Punjabi bilingual dictionary, surnames database, titles database etc and transliteration is an obviou...

Ngày tải lên: 20/02/2014, 05:20

... person names as answering who questions). This led to the general approach of analyzing parse trees to construct an XML representation of texts (i.e., attaching metadata to the text) and examining ... to serve as a tool that will enable users (such as scientists and intelligence analysts) to accumulate and manage knowledge (including facts, such as described in Fiszman et al., 2003) about t...

Ngày tải lên: 31/03/2014, 03:20

... were classified as those causing an increase in patient monitoring, a change in vital signs but without associated harm or a need for treatment or increased length of stay. Major errors were categorised ... director, according to an adapted scale [9-11]. Minor errors were classified as those causing no harm or an increase in patient monitoring with no change in vital signs and no harm not...

Ngày tải lên: 25/10/2012, 10:39

... substantia nigra is a neuropathological hallmark of Parkinson’s disease. This leads to a decreased level of dopamine in the striatum. As a result, synaptic transmission is nega- tively affected ... jbc.M110.177246. 24 Doi H, Okamura K, Bauer PO, Furukawa Y, Shimizu H, Kurosawa M, Machida Y, Miyazaki H, Mitsui K, Kuroiwa Y et al. (2008) RNA-binding protein TLS is a major nuclear aggreg...

Ngày tải lên: 14/02/2014, 19:20

... sequencing and mutational analysis of a gene cluster involved in nitrite reduction in Paracoccus denitrificans. Antonie Leeuwenhoek 66, 111–127. 13 Kawasaki S, Arai H, Kodama T & Igarashi Y (1997) Gene ... FEBS 23 Chang CK (1994) Heme d 1 and other heme cofactors from bacteria. Ciba Found Symp 180, 228–238. 24 Van Spanning RJ, Wancell CW, De Boer T, Hazelaar MJ, Anazawa H, Harms N, Oltma...

Ngày tải lên: 15/02/2014, 01:20