0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "Deep Read: A Reading Comprehension System" pdf

Báo cáo khoa học:

Báo cáo khoa học: "Deep Read: A Reading Comprehension System" pdf

... Abstract This paper describes initial work on Deep Read, an automated reading comprehension system that accepts arbitrary text input (a story) and answers questions about it. We have acquired ... "graduate" to real-world applications. Reading comprehension tests can serve as a testbed, providing an impetus for research in a number of areas: • Machine learning of lexical information, ... as a correct answer. We have implemented all three metrics. HumSent and AutSent are comparable with human benchmarks, since they provide a binary score, as would a teacher for a student's...
  • 8
  • 403
  • 1
Báo cáo khoa học:

Báo cáo khoa học: "TRANSFER IN A MULTILINGUAL MT SYSTEM" pdf

... project in the world that applies (iii) not only as a matter of principle but as actual practice. We will regard a natural language as a set of texts. A translation pair is a pair of texts (T~, ... subtree, dominated by the nonterminal node A, and (ii) t is a tree, dominated by A& apos;, and (iii) A& apos; is a copy of A& apos;, and (iv) the immediate daughters of A& apos; are copies of ... translates-as A& apos;, then we will call A& apos; a TN of A. We now call an element s,t of the set defined by translates-as a simple iff. either s and t are both terminal nodes, or (i) s is a...
  • 4
  • 285
  • 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

... TCATCTTTTAAACTTTGGGCGAAGGCGTTT23 TTTTCTCGAGAAAGATGCCGATTTGGGCGC24 GGGGCTCGAGGTTTTATATTTGTTGTAAAA25 ATATTATATATATATATAGGGTCGTATATA26 AAATTATAGAAAGCAGTAGA TAAAACAATG27 CTTCGAAGAATATACTAAAAAATGAGCAGGCAAGATAAACGAAGGCAAAGTTCAATTCATCATTTTTTTTTTATTCTTTT28 ... GCCCGGATCCTGATAGTAATAGAATCCAAA4 CCCCGAATTCAAATTATAGAAAGCAGTAGA5 AAGGCTCGAGAGATCTGTTTAGCTTGCCTC6 AAAAGTCGACGAGCTCGTTTTCGACACTGG7 TTTTGTCGACATGGCGCAACACGATGAAGCCGTAGACAAC8 GGGGGGATCCTTACATAAGCGTACAACAAACACTATTTGATTTCGGCGCCTGAGCATCATTTAGCTTTTT9 ... TTTTGTCGACATGGCGCAACACGATGAAGCCGTAGACAAC18 GGGGGGATCCTTACATAAGCGTACAACAAACACTATTTGATTTCGGCGCCTGAGCATCATTTAGCTTTTT19 ATCCAAAGTTTAGCCGATGACCCAAGCCAA20 TTGGCTTGGGTCATCGGCTAAACTTTGGAT21 AAACGCCTTCGCCCAAAGTTTAAAAGATGA22 TCATCTTTTAAACTTTGGGCGAAGGCGTTT23...
  • 9
  • 444
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "DESIGN OF A MACHINE TRANSLATION SYSTEM " pptx

... may require special crmputational treatment and that therefore a relatively shallow analysis of the text may be sufficient for automatic translation of the sublanguage. This hypothesis and ... particular sublanguage defined by our corpus, ac- ceptable translation does not necessarily depend on standard linguistic structural analysis but can be obtained with a relatively shallow analysis. ... German, French and Italian, with German usually serving as the source language (SL), French and Italian as the target language (TL). The study is hence based on a collection of texts already...
  • 4
  • 394
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "MIMA Search: A Structuring Knowledge System towards Innovation for Engineering Education" pot

... class of term variants, not for each term variant separately. Table 1: Automatic term normalization Term variants Normalised term human cancers cancer in humans human’s cancer human ... morphological, syntactic, lexico-semantic and pragmatic phenomena. Our approach to term variation management is based on term normali-zation as an integral part of the ATR process. Term variants (i.e. ... term variation management (Mima and Ananiadou, 2001). We consider a variety of sources from which term variation problems originate. In particular, we deal with orthographi-cal, morphological,...
  • 4
  • 184
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "HINDI TO PUNJABI MACHINE TRANSLATION SYSTEM" pdf

... Machine Translation system is a software designed that essentially takes a text in one language (called the source language), and translates it into another language (called the target language). ... places, objects etc. that cannot be found in translation resources such as Hindi-Punjabi bilingual dictionary, surnames database, titles database etc and transliteration is an obvious choice for ... Vishal Goyal Gurpreet Singh Lehal Department of Computer Science Department of Computer Science Punjabi University, Patiala,India Punjabi University, Patiala,India vishal.pup@gmail.com gslehal@gmail.com...
  • 6
  • 458
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "CL Research’s Knowledge Management System" pdf

... person names as answering who questions). Thisled to the general approach of analyzing parse trees toconstruct an XML representation of texts (i.e.,attaching metadata to the text) and examining ... to serve as a tool thatwill enable users (such as scientists and intelligenceanalysts) to accumulate and manage knowledge(including facts, such as described in Fiszman et al.,2003) about topics ... interest.22 Parsing and Creation of XML TaggingKMS and each of its application areas is based onparsing text and then transforming parse trees into anXML representation. CL Research uses the...
  • 4
  • 224
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"

... wereclassified as those causing an increase in patient monitoring, a change in vital signs but without associated harm or a needfor treatment or increased length of stay. Major errors werecategorised ... director, according to anadapted scale [9-11]. Minor errors were classified as thosecausing no harm or an increase in patient monitoring with nochange in vital signs and no harm noted. Moderate ... (GEHealthcare, Anapolis, MD, USA) to the ICU but not on the gen-eral wards. The new system was introduced following a pro-gram of staff training and HWP was completely changed on a single day....
  • 6
  • 526
  • 0
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

... substantianigra is a neuropathological hallmark of Parkinson’sdisease. This leads to a decreased level of dopamine inthe striatum. As a result, synaptic transmission is nega-tively affected ... jbc.M110.177246.24 Doi H, Okamura K, Bauer PO, Furukawa Y, ShimizuH, Kurosawa M, Machida Y, Miyazaki H, Mitsui K,Kuroiwa Y et al. (2008) RNA-binding protein TLS is a major nuclear aggregate-interacting protein ... of rasagiline, a MAO-B inhib-itor, on the aggregation of a- synuclein, is because of itsaction as a free radical scavenger [36]. Thus, it may bespeculated that dopamine exhibits a beneficial...
  • 11
  • 754
  • 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

... sequencingand mutational analysis of a gene cluster involved innitrite reduction in Paracoccus denitrificans. AntonieLeeuwenhoek 66, 111–127.13 Kawasaki S, Arai H, Kodama T & Igarashi Y (1997)Gene ... FEBS23 Chang CK (1994) Heme d1and other heme cofactorsfrom bacteria. Ciba Found Symp 180, 228–238.24 Van Spanning RJ, Wancell CW, De Boer T, HazelaarMJ, Anazawa H, Harms N, Oltmann LF & ... total cell lysate and theperiplasmic fraction, but was absent from the membrane and cytoplasmic fractions. (B) The same cell fractions as shown in (A) when sub-jected to SDS ⁄ PAGE analysis and...
  • 12
  • 613
  • 0

Xem thêm

Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM