Báo cáo khoa học: "Exploring the Characteristics of Multi-Party Dialogues" docx
... example, are there any possibilities if in multi-party di- alogues the role of chairpersons emerges from the nature of the dialogues? These are not only problems in exploring multi-party dialogues. ... examine whether there are differences of the number of characters and turns between speakers. The results indicates that there are statistically no differences at ....
Ngày tải lên: 31/03/2014, 04:20
... for the LPE experiments because of the ceiling effect and the small size of the complete data set, therefore, we did not rerun the corresponding experiments. Furthermore, the number of codebook ... the other way around. Composition of feature vectors: Another lesson of Tab. 3 is that the effect of the com- position of the feature vectors can vary depend...
Ngày tải lên: 22/02/2014, 03:20
... the following parameters. L consisted of three labeling schemes: the set L wd of word labels, the set L pt of preterminal labels, and the set L nt of nonterminal labels. The or- der < of the ... V n L denote the finite subset of V L that includes pre- cisely the model variables of the form S ij or L k ij , where j ≤ n. Basically then, our model consists of...
Ngày tải lên: 31/03/2014, 01:20
Tài liệu Báo cáo khoa học: "Analyzing the Errors of Unsupervised Learning" docx
... paper, we analyze the following three model families: In the HMM, the input x is a sequence of words and the output y is the corresponding sequence of part -of- speech tags. In the PCFG, the input x ... that the first iteration of EM reinforces the systematic mis- takes of the supervised initializer. In the first E-step, the posterior counts that are computed sum...
Ngày tải lên: 20/02/2014, 09:20
Báo cáo khoa học: "On the Problem of Mechanical Translation" docx
... to the standard rules of Russian grammar. 4. Storing in the dictionary all the constant grammatical properties of words. 5. Determination of multiple meanings of the words from the ... the practice test to which they were subjected. Hence it seems to us that they constitute a re- liable basis for the solution of the problem of MT. The contents of...
Ngày tải lên: 30/03/2014, 17:20
Tài liệu Báo cáo khoa học: Receptor binding characteristics of the endocrine disruptor bisphenol A for the human nuclear estrogen-related receptor c pptx
... Given that the roles of these residues definitely confirm each other, the dif- ference in their significance might be attributable to the importance and ⁄ or necessity of the receipt of the phenol-hydroxyl ... environments of BPA in the ligand-binding pocket of the ERRc. The proximity of each amino acid residue (within a distance of 5 A ˚ ) to BPA is shown in the...
Ngày tải lên: 18/02/2014, 16:20
Báo cáo khoa học: DNA-binding characteristics of the regulator SenR in response to phosphorylation by the sensor histidine autokinase SenS from Streptomyces reticuli doc
... released with the same solution in the presence of 250 mm imidaz- ole. The protein concentration of the samples was deter- mined by a previously established method [42]. The quality of the proteins ... GACGGAATTCAGGATCGGTTCCGG (located upstream of hbpS and ending at the 5 ¢-end of the inverted repeat) H REcofor GCTCGAATTCCGTCCCGTCGCCGG (located upstream of hbpS and...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: "Exploring the Sense Distributions of Homographs" docx
... to s2, with the only difference being that the concordances of the homographs are replaced by the concordances of the instances of w1. Regarding the interpretation of the results, if the ratio ... we look at the number of undecided cases is that the problem of data sparseness is much more severe if we consider the concordances of the homographs rather tha...
Ngày tải lên: 08/03/2014, 21:20
Tài liệu Báo cáo khoa học: Seeking the determinants of the elusive functions of Sco proteins pptx
... function of the CXXXC motif of human Sco proteins could therefore be impli- cated not only in the maturation of the Cu A site of Cox2 but also in the maintenance of cellular copper homeostasis. The ... Blackburn NJ (2011) The essential role of the Cu(II) state of Sco in the maturation of the Cu(A) center of cytochrome oxi- dase: evidence from H135Met and H1...
Ngày tải lên: 14/02/2014, 18:20
Tài liệu Báo cáo khoa học: Glucuronate, the precursor of vitamin C, is directly formed from UDP-glucuronate in liver pptx
... procedure. The finding that the effect of CoASH depends on the presence of ATP (although not of other NTPs such as GTP and UTP; not shown) suggests that it is indirectly mediated via the formation of ... 20%, despite the presence of ATP- Mg. It is shown below that this is due to loss of the inhibitory effect of ATP-Mg, consequent to the removal of a heat-stable co...
Ngày tải lên: 19/02/2014, 07:20