Báo cáo khoa học: "Finding Ideographic Representations of Japanese Names Written in Latin Script via Language Identification and Corpus Validation" docx

Báo cáo khoa học: "Finding Ideographic Representations of Japanese Names Written in Latin Script via Language Identification and Corpus Validation" docx

Báo cáo khoa học: "Finding Ideographic Representations of Japanese Names Written in Latin Script via Language Identification and Corpus Validation" docx

... Finding Ideographic Representations of Japanese Names Written in Latin Script via Language Identification and Corpus Validation Yan Qu Clairvoyance Corporation ... transcribed into pinyin, retrieval was based on pinyin-to-pinyin matching; pinyin to Chinese character conversion was not addressed. Names other than Chinese names were considered as foreign n...

Ngày tải lên: 31/03/2014, 03:20

8 356 0
Tài liệu Báo cáo khoa học: C-Terminal extension of a plant cysteine protease modulates proteolytic activity through a partial inhibitory mechanism doc

Tài liệu Báo cáo khoa học: C-Terminal extension of a plant cysteine protease modulates proteolytic activity through a partial inhibitory mechanism doc

... subsites of Erv-C with Leu23 in the S2 pocket, considering the specificity of Erv-C towards a Leu residue [17]. The mode of interactions of mini-chain of human lyso- somal cysteine protease cathepsin ... studies based on the high-reso- lution structures of papain and actinidin, and on amino acid sequence information for cathepsins B and H, and stem bromelain. J Mol Biol 1...

Ngày tải lên: 14/02/2014, 14:20

13 760 0
Tài liệu Báo cáo khoa học: "An Implemented Description of Japanese: The Lexeed Dictionary and the Hinoki Treebank" ppt

Tài liệu Báo cáo khoa học: "An Implemented Description of Japanese: The Lexeed Dictionary and the Hinoki Treebank" ppt

... glosses) grammar in tandem with the treebank, as part of our research into natural language understanding. Treebanking the output of the parser allows us to immediately identify problems in the grammar, and ... the use of similarity and/ or se- mantic class based back-offs for parsing and gen- eration with both symbolic grammars and statisti- cal models. In order to make...

Ngày tải lên: 20/02/2014, 12:20

4 536 0
Tài liệu Báo cáo khoa học: Solution NMR structure of five representative glycosylated polyene macrolide antibiotics with a sterol-dependent antifungal activity doc

Tài liệu Báo cáo khoa học: Solution NMR structure of five representative glycosylated polyene macrolide antibiotics with a sterol-dependent antifungal activity doc

... solution structures of five representative glycosylated members, three tetraenes (pimaricin, nystatin A1 and rimocidin) and two heptaenes (candidin and vacidin A) have been calculated using geometric restraints ... energy minimization. RESULTS NMR assignments of nystatin A1 and rimocidin in methanol- d 4 The structure-specific assignment of the 1 Hand 13 C resonances of nystat...

Ngày tải lên: 21/02/2014, 03:20

9 522 0
Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt

Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt

... v) Triton X-100 and 0.2 mm kynuramine. The activity was calculated by following the initial increase of A 316 due to production of 4-hydroxyquinone and using an extinction coefficient of 12 000 m )1 Æcm )1 [28]. ... limiting rate of flavin reduction (k red ) and the substrate binding con- stant (K s ) were determined as described by Strickland et al. [30] using the origin software...

Ngày tải lên: 07/03/2014, 06:20

9 327 0
Báo cáo khoa học: DNA-binding characteristics of the regulator SenR in response to phosphorylation by the sensor histidine autokinase SenS from Streptomyces reticuli doc

Báo cáo khoa học: DNA-binding characteristics of the regulator SenR in response to phosphorylation by the sensor histidine autokinase SenS from Streptomyces reticuli doc

... GCCGAATTCTCCTCAGCATGTCCAG (located upstream of hbpS and ending at the 5¢-end of binding site II) D IIEcofor CGAGAATTCGGGGGCGTCGGTCGC (located upstream of hbpS and beginning at the 3¢-end of binding site II) IIPstrev ... (located upstream of hbpS and ending at the 5 ¢-end of the inverted repeat) H REcofor GCTCGAATTCCGTCCCGTCGCCGG (located upstream of hbpS and beginning at...

Ngày tải lên: 07/03/2014, 10:20

14 428 0
Báo cáo khoa học: "A Computational Analysis of Complex Noun Phrase in Messages" docx

Báo cáo khoa học: "A Computational Analysis of Complex Noun Phrase in Messages" docx

... sources of text compression by two means: (1) comparing a full grammar of the standard language to that of the domain in which we are working, 505 and {2) comparing the distribution of constructions ... descriptive, naming parts in terms of their function and relation to other parts, and also describing the status of parts and other objects in the sublanguage....

Ngày tải lên: 08/03/2014, 18:20

4 516 0
Báo cáo khoa học: Electron-transfer subunits of the NiFe hydrogenases in Thiocapsa roseopersicina BBS pptx

Báo cáo khoa học: Electron-transfer subunits of the NiFe hydrogenases in Thiocapsa roseopersicina BBS pptx

... ampicillin (100), kanamycin (25), tetracyclin (20); for T. roseopersicina, kanamycin (25), streptomycin (5) and gentamycin (5). Expression of the hynS-isp1-isp2-hynL* genes of T. roseopersicina in ... membrane and can be easily Table 1. Activities of Hyn hydrogenase in vivo and in vitro in the presence and absence of the Isp1 and Isp2 proteins. The results are given...

Ngày tải lên: 16/03/2014, 03:20

11 390 0
Báo cáo khoa học: "Examining the Role of Linguistic Knowledge Sources in the Automatic Identification and Classification of Reviews" doc

Báo cáo khoa học: "Examining the Role of Linguistic Knowledge Sources in the Automatic Identification and Classification of Reviews" doc

... Knowledge Sources in the Automatic Identification and Classification of Reviews Vincent Ng and Sajib Dasgupta and S. M. Niaz Arifin Human Language Technology Research Institute University of Texas at ... role of four types of sim- ple linguistic knowledge sources in a po- larity classification system. 1 Introduction Sentiment analysis involves the identification of p...

Ngày tải lên: 17/03/2014, 04:20

8 489 0
w