Báo cáo khoa học: "MIMA Search: A Structuring Knowledge System towards Innovation for Engineering Education" pot

... class of term variants, not for each term variant separately. Table 1: Automatic term normalization Term variants Normalised term human cancers cancer in humans human’s cancer human ... their evalua- tions can be referred in (Mima et al., 2001; Mima and Ananiadou, 2001). 4 Structuring knowledge Structuring knowledge can be regarded as a broader approach to IE/KA. IE a...

Ngày tải lên: 31/03/2014, 01:20

... an ‘instant’ PDC. It appears that it will be easier to expand the active site to accept larger substrates and, as shown for benzoylformate decarboxylase [16], satu- ration mutagenesis of at least ... the A. brasilense enzyme showed a ten-fold greater k cat ⁄ K m for PPA than for IPyA, no activity with benzoylfor- mate, and substrate activation was observed with IPyA and several other...

Ngày tải lên: 06/03/2014, 00:21

... PA1b: five susceptible strains ÔS. oryzae WAA42, Benin, and Bouriz, S. zeamais LS, and S. granarius BrayardÕ and four fully resistant S. oryzae strains ÔISOR3, Mex1, China and GVÕ harboring a ... specific radioactivity of the 125 I-labelled PA1b, calculated by the ratio of the radioactivity measured by gamma counting and the amount of peptide evaluated by absorbance at 210 nm during HPLC anal...

Ngày tải lên: 08/03/2014, 02:21

... project in the world that applies (iii) not only as a matter of principle but as actual practice. We will regard a natural language as a set of texts. A translation pair is a pair of texts (T~, ... Dutch 'graag' is not translated at all; it only serves as a basis for the complex transfer elementKC,l~. The principle of simple transfer can now be formulated as f...

Ngày tải lên: 08/03/2014, 18:20

... TCATCTTTTAAACTTTGGGCGAAGGCGTTT 23 TTTTCTCGAGAAAGATGCCGATTTGGGCGC 24 GGGGCTCGAGGTTTTATATTTGTTGTAAAA 25 ATATTATATATATATATAGGGTCGTATATA 26 AAATTATAGAAAGCAGTAGA TAAAACAATG 27 CTTCGAAGAATATACTAAAAAATGAGCAGG CAAGATAAACGAAGGCAAAGTTCAATTCA TCATTTTTTTTTTATTCTTTT 28 ... GCCCGGATCCTGATAGTAATAGAATCCAAA 4 CCCCGAATTCAAATTATAGAAAGCAGTAGA 5 AAGGCTCGAGAGATCTGTTTAGCTTGCCTC 6 AAAAGTCGACGAGCTCGTTTTCGACACTGG 7 TT...

Ngày tải lên: 16/03/2014, 01:20

... may require special crmputational treatment and that therefore a relatively shallow analysis of the text may be sufficient for automatic translation of the sublanguage. This hypothesis and ... MT system, actual trans- lation takes place in transfer and can be descri- bed as the ocr~putaticnal manipulation of tree structures. In the absenoe of any formal theory of translation for...

Ngày tải lên: 17/03/2014, 19:21

... tests as a research problem and an evaluation method for language understanding systems. Such tests can take the form of standardized multiple-choice diagnostic reading skill tests, as well as ... Abstract This paper describes initial work on Deep Read, an automated reading comprehension system that accepts arbitrary text input (a story) and answers questions about it. We hav...

Ngày tải lên: 31/03/2014, 04:20

... Clinical Information System (CIS) (GE Healthcare, Anapolis, MD, USA) to the ICU but not on the gen- eral wards. The new system was introduced following a pro- gram of staff training and HWP was ... did not affect the patient but, in these cases, nurses administered medication without a legally valid physi- cian order. Although an absent 'signature' with CPOE was regarded as...

Ngày tải lên: 25/10/2012, 10:39

... substantia nigra is a neuropathological hallmark of Parkinson’s disease. This leads to a decreased level of dopamine in the striatum. As a result, synaptic transmission is nega- tively affected ... jbc.M110.177246. 24 Doi H, Okamura K, Bauer PO, Furukawa Y, Shimizu H, Kurosawa M, Machida Y, Miyazaki H, Mitsui K, Kuroiwa Y et al. (2008) RNA-binding protein TLS is a major nuclear aggreg...

Ngày tải lên: 14/02/2014, 19:20

... 111–127. 13 Kawasaki S, Arai H, Kodama T & Igarashi Y (1997) Gene cluster for dissimilatory nitrite reductase (nir) from Pseudomonas aeruginosa: sequencing and identifi- cation of a locus for heme ... FEBS 23 Chang CK (1994) Heme d 1 and other heme cofactors from bacteria. Ciba Found Symp 180, 228–238. 24 Van Spanning RJ, Wancell CW, De Boer T, Hazelaar MJ, Anazawa H, Harms N, Oltman...

Ngày tải lên: 15/02/2014, 01:20