Báo cáo khoa học: "Compiling a Lexicon of Cooking Actions for Animation Generation" doc

... Generation Kiyoaki Shirai Hiroshi Ookawa Japan Advanced Institute of Science and Technology 1-1, Asahidai, Nomi, 923-1292, Ishikawa, Japan {kshirai,h-ookawa}@jaist.ac.jp Abstract This paper describes ... actions, rather than on animation generation. Implementa- tion of the complete Animation Generator as well as a description of the action plans for all basic actions in the...

Ngày tải lên: 31/03/2014, 01:20

... spans; for exam- ple, because, since, and for this reason are dif- ferent markers for causal relations. Discourse markers are a syntactically quite heterogeneous group of words, many of ... which are traditionally treated as function words belonging to the realm of grammar rather than to the lexicon. But for a single discourse relation there is often a set of si...

Ngày tải lên: 20/02/2014, 18:20

... laboratory has generated recombinant constructs of the mature forms of PrPs from a variety of mammalian and nonmamma- lian species, and of partial sequences thereof. In addi- tion, designed variants ... listings of plasmids that encode the mature forms, devoid of the signal sequences, of natural and modified PrPs from a variety of mamma- lian and nonmammalian species, which...

Ngày tải lên: 18/02/2014, 08:20

... NUMBER OF DEPOSITS AND WITHDRAWALS, AND THE FINAL BALANCE. THE ACCOUNTS AND TRANSACTIONS FOR AN ACCOUNTING PERIOD WILL BE GIVEN ON PUNCHED CARDS AS FOLLOWS: FIRST WILL BE A SEQUENCE OF CARDS ... Example 1 An instructor records the name and five test scores on a data card for each student. The regis- trar also supplies data cards containing a student name, identification...

Ngày tải lên: 21/02/2014, 20:20

... GGGGGATCCGGTACAGATGTAACAAATAAAG BamHI rFnBPB 163–463 R ATTCCCGGGTAATTTTTCCAAGTTAAATTACTTG SmaI rFnBPB 163–308 F GGGGGATCCGGTACAGATGTAACAAATAAAG BamHI rFnBPB 163–308 R CTCCCCGGGCTATTGAATATTAAATATTTTGCTAA ... GAATTATCTTTAGCTCTAGCTATTGATCC rFnBPB 163–480 NF F GGATCAATAGCTAGAGCTAAAGATAATTC FnBPB (–142–480) F GCAGAATTCGTCGGCTTGAAATACGCTG EcoRI FnBPB (–142–480) R AATGGATCCTTACTTTAGTTTATCTTTGCCG Bam...

Ngày tải lên: 06/03/2014, 00:20

... Edmonton, AB, Canada Type IIa bacteriocins, which are isolated from lactic acid bacteria that are useful for food preservation, are potent antimicrobial peptides with considerable potential as therapeutic ... IIa bacteriocin activity Tara Sprules 1 , Karen E. Kawulka 1 , Alan C. Gibbs 2 , David S. Wishart 2 and John C. Vederas 1 1 Department of Chemistry and 2 Faculty of Pharmacy, Unive...

Ngày tải lên: 07/03/2014, 15:20

... et al. (2005). The re- search established that even a small amount of ad- ditional training data can give a substantial im- provement in question analysis in terms of both CFG parse accuracy and ... from appropri- ate treebank material. However, treebank- and machine learning-based grammatical resources re- flect the characteristics of the training data. They generally underperform o...

Ngày tải lên: 08/03/2014, 02:21

... pressure, and assume that learning takes place in an environment where simple semantic representations of the speech intent are available to the acquisition mechanism. For example, we approximate ... programs. 2 A Simple Prototype We have implemented a simple algorithm as an ex- ploratory effort. It maintains a single dictionary, a set of words. Each word consists of a...

Ngày tải lên: 08/03/2014, 07:20

... performed for the cysteine proteases papain, cathepsin L and cathepsin V using benzyloxycar- bonyl (Z)-Phe-Arg-7-amido-4-methylcoumarin (AMC) as substrate, and for legumain with Z-Ala-Ala-Asn-AMC ... Z-Ala-Ala-Asn-AMC as the substrate, while stopped assays were performed for cathepsins K, S and B using Z-Phe-Arg-AMC as the sub- strate and for cathepsin H with Arg-AMC as the substrate...

Ngày tải lên: 16/03/2014, 02:20

... Table -of- Contents S.R.K. Branavan, Pawan Deshpande and Regina Barzilay Massachusetts Institute of Technology {branavan, pawand, regina}@csail.mit.edu Abstract This paper presents a method for the auto- matic ... Most of these approaches are tailored to a par- 1 The code and feature vector data for our model and the baselines are available at http://people.csail.mit.edu/branavan/...

Ngày tải lên: 17/03/2014, 04:20