Báo cáo khoa học: An ‘Old World’ scorpion b-toxin that recognizes both insect and mammalian sodium channels A possible link towards diversification of b-toxins ppt

Báo cáo khoa học: An ‘Old World’ scorpion b-toxin that recognizes both insect and mammalian sodium channels A possible link towards diversification of b-toxins ppt

Báo cáo khoa học: An ‘Old World’ scorpion b-toxin that recognizes both insect and mammalian sodium channels A possible link towards diversification of b-toxins ppt

... An ‘Old World’ scorpion b-toxin that recognizes both insect and mammalian sodium channels A possible link towards diversification of b-toxins Dalia Gordon 1 , Nitza Ilan 1,6 , Noam Zilberberg 2 , ... various insect and mammalian sodium channels [1,2,21,22]. As b-toxins that affect mammalian sodium channels have not been identified in...

Ngày tải lên: 31/03/2014, 01:20

8 391 0
Tài liệu Báo cáo khoa học: An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity pdf

Tài liệu Báo cáo khoa học: An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity pdf

... An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity Stephanie Ngai, Sarah Batty, Kuo-Chieh Liao and Jeremy Mogridge Department of Laboratory ... inducing vascular leakage that leads to shock and multiorgan failure [3–6]. The role of LeTx in anthrax pathogenesis is complex, however, and probably involves the impairment of the...

Ngày tải lên: 16/02/2014, 09:20

9 579 0
Báo cáo khoa học: An orphan dermaseptin from frog skin reversibly assembles to amyloid-like aggregates in a pH-dependent fashion pptx

Báo cáo khoa học: An orphan dermaseptin from frog skin reversibly assembles to amyloid-like aggregates in a pH-dependent fashion pptx

... Hesser 2 , Martin Muik 3 , Christian Wechselberger 4 and Alexander Jilek 1 1 Institute of Organic Chemistry, Johannes Kepler University Linz, Austria 2 CSNA Center for Surface- and Nanoanalytics, Johannes ... Microscope Sciences, Hatfield, PA, USA) or NanoVan (Nanoprobes, Yaphank, NY, USA) and examined with a Jeol 2010 electron microscope (Tokyo, Japan) operated at 100 kV. FTIR Hydro...

Ngày tải lên: 23/03/2014, 04:20

11 412 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... Ray A, Xue L & Rando RR (2003) Purification and characterization of a transmembrane domain-deleted form of lecithin retinol acyltransferase. Biochemistry 42, 6090–6098. 45 Muniz A, Villazana-Espinoza ... AYRAAYTCRWRBCCYTTCCA RPE6 5a- Fwd NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAA...

Ngày tải lên: 14/02/2014, 14:20

14 754 0
Tài liệu Báo cáo khoa học: An autoinhibitory effect of the homothorax domain of Meis2 ppt

Tài liệu Báo cáo khoa học: An autoinhibitory effect of the homothorax domain of Meis2 ppt

... Santa Clara, CA, USA). For quantitative RT-PCR, cDNA was generated using Superscript III (Invitrogen), and analyzed by PCR using a DNA engine cycler and Promega Taq. Intron-spanning primer pairs ... proteins, and the (Gal) 5 -TATA lucifer- ase reporter (A) , or the (Gal) 5 -SV40 reporter (B). Luciferase activity was assayed after 48 h, and is presented as the mean + standard devia-...

Ngày tải lên: 16/02/2014, 15:20

14 753 0
Tài liệu Báo cáo khoa học: An allosteric DNAzyme with dual RNA-cleaving and DNA-cleaving activities doc

Tài liệu Báo cáo khoa học: An allosteric DNAzyme with dual RNA-cleaving and DNA-cleaving activities doc

... DNA sequences (PL DNAzyme, 5¢-GAATTCTAATAC GACTCAGAATGAGTCTGGGCCTCTTTTTAAGAAC-3¢; 8–17 variant DNAzyme, 5¢-AATACTCCGAGCCGGTCG GGCCTC-3¢; DRc DNAzyme, 5¢-GAATTCTAATACTCC GAGCCGGTCGGGCCTCTTTTTAAGAAC-3¢) ... 7.0) at 23 °C. The self-cleavage of DRc DNAzyme was A BC FED Fig. 3. Characterization of the DNA-cleaving and RNA-cleaving reactions catalyzed by DRc DNAzyme. (A C) Analyses of DNA...

Ngày tải lên: 16/02/2014, 15:20

7 602 0
Tài liệu Báo cáo khoa học: An ecdysteroid-inducible insulin-like growth factor-like peptide regulates adult development of the silkmoth Bombyx mori docx

Tài liệu Báo cáo khoa học: An ecdysteroid-inducible insulin-like growth factor-like peptide regulates adult development of the silkmoth Bombyx mori docx

... consisting of an A- chain and a B-chain, whereas IGFs are single- chain peptides with domains B, C, A and D, and the major function of insulin is to control carbohydrate metabolism, whereas that of IGFs ... the female (C) and male (D) disks before and after cultivation for 5 days. Values are the means and standard errors of the mean (n = 6). (E–H) Confocal images...

Ngày tải lên: 18/02/2014, 13:20

12 707 0
Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

... equation: DG p ¼ nFDl Na þ where n is the number of translocated ions and F is the Faraday constant. The c subunit of the eukaryal V 1 V 0 ATPases present in organelles arose by duplication and ... has only 10 membrane-buried negative charges that are essential for binding the ion and also for the rotational mechanism of the ring. The c ring of I. tartaricus has 11 negative ch...

Ngày tải lên: 18/02/2014, 17:20

9 773 0
Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf

Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf

... N-terminal Flag tag and a C-terminal Myc tag, and this was followed by expression in HCT116 p53 + ⁄ + cells. Two major trans- fected bands were observed: a 44 kDa upper band, and a 40 kDa lower band ... glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA quantification in colon carcinoma and rectal carcinoma as compared to normal colonic tissue. Colon carcinoma cells, rectal ca...

Ngày tải lên: 18/02/2014, 17:20

11 659 0
Tài liệu Báo cáo khoa học: An investigation of the substrate specificity of the xyloglucanase Cel74A from Hypocrea jecorina pdf

Tài liệu Báo cáo khoa học: An investigation of the substrate specificity of the xyloglucanase Cel74A from Hypocrea jecorina pdf

... (Northampton, MA, USA). The ther- mal denaturation of Cel7 4A was completely irreversible, and no transition was seen in a repeat scan; therefore, an apparent T m was approximated as the midpoint of the DSC ... xyloglucanases are discussed. Results and Discussion Protein characterization Cel7 4A was purified to apparent homogeneity from an engineered strain of H. jecorina by...

Ngày tải lên: 19/02/2014, 05:20

8 646 0
w