Báo cáo khoa học: "Dictionary Definitions based Homograph Identification using a Generative Hierarchical Model" docx

Báo cáo khoa học: "Dictionary Definitions based Homograph Identification using a Generative Hierarchical Model" docx

Báo cáo khoa học: "Dictionary Definitions based Homograph Identification using a Generative Hierarchical Model" docx

... dic- tionary definitions. After training, each of the 225 words was annotated by each annotator. On aver- age, annotators categorized each word in just 19 seconds. The inter-annotator agreement was ... agreed. The best agreement between the gold standard and a human annotator was 0.87 kappa, and the worst was 0.78. The class distribu- tion (homographs and non-homographs) was 0.63, 0.3...
Ngày tải lên : 31/03/2014, 00:20
  • 4
  • 282
  • 0
Báo cáo khoa học: "Automated Whole Sentence Grammar Correction Using a Noisy Channel Model" pptx

Báo cáo khoa học: "Automated Whole Sentence Grammar Correction Using a Noisy Channel Model" pptx

... erroneous 0 1 a: a/0.6 2 an:an/0.4 3 cat:cat/1 4 ear:ear/1 5 ε:ε/1 ε:ε/1 0 a: a/0.95[0.95,0] a: an/0.05[0,0.05] an:an/1 cat:cat/1 ear:ear/1 0 1 a: a/0.57[0.57,0] a: an/0.03[0,0.03] 2 an:an/0.4 3 cat:cat/1 4 ear:ear/1 5 ε:ε/1 ε:ε/1 Figure ... the twelfth national conference on Artificial intelli- gence (vol. 1), AAAI ’94, pages 779–784, Menlo Park, CA, USA. American Association for Artifi-...
Ngày tải lên : 23/03/2014, 16:20
  • 11
  • 367
  • 0
Báo cáo khoa học: "Semantic-Head Based Resolution of Scopal Ambiguities* BjSrn Gamb/ick" docx

Báo cáo khoa học: "Semantic-Head Based Resolution of Scopal Ambiguities* BjSrn Gamb/ick" docx

... pronoun 'das' is pron, marking unresolved anaphora. 'auch' and 'nicht' are handled as operators. The verb con- dition (passen) and its pronoun subject are in ... by variables ("holes") ranging over labels. Labels are written as ln, holes as hn, and vari- ables over individuals as in. The labelling allows us to state meta-level constraints ......
Ngày tải lên : 17/03/2014, 07:20
  • 5
  • 249
  • 0
Tài liệu Báo cáo khóa học: The lysozyme of the starfishAsterias rubens A paradigmatic typei lysozyme docx

Tài liệu Báo cáo khóa học: The lysozyme of the starfishAsterias rubens A paradigmatic typei lysozyme docx

... (5¢fi3¢) Corresponding peptide AS1 GGTTGCCTGAGRTGYATHTG a GCLRCIC AS3 GGGCTATTGGTCAGACGCTACACTC GYWSDATL AS3R GAGTGTAGCGTCTGACCAATAGCC GYWSDATL AS4R GATCTGATACGGTCCACACGACAG LSCGPYQI a H ¼ A or C or T; R ¼ AorG;Y¼ ... 12 0A PTH analyser. Synthesis of cDNA Total RNA was extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. It was treated with RNAase...
Ngày tải lên : 19/02/2014, 12:20
  • 6
  • 737
  • 0
Báo cáo khoa học: "Unsupervised Learning of Arabic Stemming using a Parallel Corpus" pot

Báo cáo khoa học: "Unsupervised Learning of Arabic Stemming using a Parallel Corpus" pot

... Phrase: the advisory committee Arabic Phrase: Alljnp AlAst $ Aryp Task: stem AlAst $ Aryp Choices Score AlAst$Aryp 0.8 AlAst$Aryp 0.7 AlAst$Ary 0.6 AlAst$Aryp 0.1 . . . . . . Figure 4: Alternate ... is a language-independent algo- rithm. English Phrase: the advisory committee Arabic Phrase: Alljnp AlAst $ Aryp Task: stem AlAst $ Aryp Choices Score AlAst$Aryp 0.2 AlAst$Aryp 0.7 AlAst$Aryp .....
Ngày tải lên : 08/03/2014, 04:22
  • 8
  • 424
  • 0
Báo cáo khoa học: "Joint Hebrew Segmentation and Parsing using a PCFG-LA Lattice Parser" docx

Báo cáo khoa học: "Joint Hebrew Segmentation and Parsing using a PCFG-LA Lattice Parser" docx

... unlexicalized, treebank-derived gram- mars, and showed that better grammars contribute to better segmentation accuracies. Goldberg et al. (2009) showed that segmentation and parsing ac- curacies can ... which capture many latent syntactic interactions. At in- ference time, the latent annotations are (approxi- mately) marginalized out, resulting in the (approx- imate) most probable unannotated...
Ngày tải lên : 17/03/2014, 00:20
  • 6
  • 376
  • 0
Báo cáo khoa học: " Parsing the Wall Street Journal using a Lexical-Functional Grammar and Discriminative Estimation Techniques" doc

Báo cáo khoa học: " Parsing the Wall Street Journal using a Lexical-Functional Grammar and Discriminative Estimation Techniques" doc

... grammar coverage, i.e. the fact that not all sentences receive an analysis, is tack- led in our approach by an extension of a full- fledged Lexical-Functional Grammar (LFG) and a constraint -based ... Parsing the Wall Street Journal using a Lexical-Functional Grammar and Discriminative Estimation Techniques Stefan Riezler Tracy H. King Ronald M. Kaplan Palo Alto Research Center Palo A...
Ngày tải lên : 23/03/2014, 20:20
  • 8
  • 477
  • 0
Báo cáo khoa học: "What’s There to Talk About? A Multi-Modal Model of Referring Behavior in the Presence of Shared Visual Information" potx

Báo cáo khoa học: "What’s There to Talk About? A Multi-Modal Model of Referring Behavior in the Presence of Shared Visual Information" potx

... Second, we plan to appreciably enhance the integrated model. It appears from both our initial data analysis, as well as our qualitative examina- tion of the data, that the pairs make tradeoffs be- tween ... behavior in the pres- ence of visual information could enable agents to emulate many elements of more natural and real- istic human conversational behavior. A computational model may...
Ngày tải lên : 24/03/2014, 03:20
  • 8
  • 567
  • 0
Báo cáo khoa học: Novel strategy for protein production using a peptide tag derived from Bacillus thuringiensis Cry4Aa pptx

Báo cáo khoa học: Novel strategy for protein production using a peptide tag derived from Bacillus thuringiensis Cry4Aa pptx

... Sakamoto 1 , Takaaki Yamashita 1 , Motoaki Uchida 1 , Kenji Matsushima 1 , Yohko Kashino 1 and Hiroshi Sakai 1 1 Graduate School of Natural Science and Technology, Okayama University, Japan 2 Department ... 3-1-1 Tsushima-Naka, Okayama 700-8530, Japan Fax ⁄ Tel: +81 86 251 8203 E-mail: sakahrsh@biotech.okayama-u.ac.jp Database The nucleotide sequence of the synthetic gene cry4Aa-S2 is availab...
Ngày tải lên : 29/03/2014, 09:20
  • 9
  • 371
  • 0
Báo cáo khoa học: "Semantic Analysis of Japanese Noun Phrases: A New Approach to Dictionary-Based Understanding" doc

Báo cáo khoa học: "Semantic Analysis of Japanese Noun Phrases: A New Approach to Dictionary-Based Understanding" doc

... Dictionary -based analysis (abbreviated to DBA hereafter) for semantic-role relations. 2. Semantic feature -based analysis (abbrevi- ated to SBA hereafter) for some semantic- role relations and all ... N1 and a semantic role of a head word. All definition sentences in RSK were analyzed by JUMAN, a Japanese morphological analyzer, and KNP, a Japanese syntactic and case ana-...
Ngày tải lên : 08/03/2014, 06:20
  • 8
  • 553
  • 0

Xem thêm