Báo cáo khoa học: "Mine the Easy, Classify the Hard: A Semi-Supervised Approach to Automatic Sentiment Classification" pot
... automatically identify and label the unambiguous (i.e., “easy”) reviews, then handle the ambiguous (i.e., “hard”) reviews using a discriminative learner to bootstrap from the automatically labeled ... accuracy and Adjusted Rand Index for the five datasets. second eigenvector values) in combination with the active learning points as labeled data (and the rest as unlabeled data)....
Ngày tải lên: 30/03/2014, 23:20
... Semantic Analysis of Japanese Noun Phrases : A New Approach to Dictionary-Based Understanding Sadao Kurohashi and Yasuyuki Sakai Graduate School of Informatics, Kyoto University Yoshida-honmachi, ... a Japanese morphological analyzer, and KNP, a Japanese syntactic and case ana- lyzer (Kurohashi and Nagao, 1994; Kurohashi and Nagao, 1998). Then, a genus word for a head wo...
Ngày tải lên: 08/03/2014, 06:20
... chapter a graph grammar formalism based on the notions of relational graph grammars (Rajlich 1975) and attributed programmed graph grammars (Bunke 1982) is developed for parsing languages with ... SEMANIIC PARSING AS GRAPH LANGUAGE TRANSFORMATION - A MULIIDIMENSIONAL APPROACH TO PARSING HIGHLY INFLECTIONAL LANGUAGES Eero Hyv~nen He]sJnkJ IJniversity of TechnoloQy DiaJtal Sy...
Ngày tải lên: 17/03/2014, 19:21
Báo cáo khoa học: "Identifying High-Impact Sub-Structures for Convolution Kernels in Document-level Sentiment Classification" doc
... Sheridan, Cathal Gurrin, and Alan F. Smeaton. 2009. Exploring the use of paragraph-level annotations for sentiment analysis of financial blogs. In Proceedings of the Workshop on Opinion Mining and Sentiment ... Passonneau. 2011. Sentiment analysis of twitter data. In Proceedings of the Workshop on Languages in Social Media, pages 30–38. Association for Computational Linguistics. Ra...
Ngày tải lên: 30/03/2014, 17:20
Báo cáo khoa học: Protein transport into canine pancreatic microsomes A quantitative approach potx
... both analyses, calculations were based on data points that l ay in the linear range of the densitometry signals. We note that the calculations are based on the assumption that staining with Coomassie ... an SRP-dependent manner and cotranslationally, yeast pre- pro -a- factor (Fig. 2D, bars 3 and 4 vs. 1 and 2), and a precursor that is transported predominantly in an SRP- dependent...
Ngày tải lên: 30/03/2014, 15:20
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc
... NA TGCARRAAYATHTTYTCCAG Deg RPE65-Rev AYRAAYTCRWRBCCYTTCCA RPE6 5a- Fwd NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev ... CTGAGGTTACAGACAACTGTTC 13cIMH GSP-Rev CCTTTGACATCGCAAGTGGATCA RPE65c GSP-Fwd NM_001113653 TTGAGGTGACAGACAATTGCCT RPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCG RPE6 5a-...
Ngày tải lên: 14/02/2014, 14:20
Tài liệu Báo cáo khoa học: Regulation of DNA fragmentation: the role of caspases and phosphorylation doc
... 118–127. 17 Enari M, Sakahira H, Yokoyama H, Okawa K, Iwamatsu A & Nagata S (1998) A caspase-activated DNase that degrades DNA during apoptosis, and its inhibitor ICAD. Nature 391, 43–50. 18 Hanus ... oligonu- cleosomal DNA fragmentation [14]. In addition, caspases are a key mediator of DNA fragmentation. Caspases activate most apoptotic path- ways through the cleavage of a wide...
Ngày tải lên: 14/02/2014, 22:20
Tài liệu Báo cáo khoa học: Basis of recognition between the NarJ chaperone and the N-terminus of the NarG subunit from Escherichia coli nitrate reductase pdf
... peptide after saturation. The obtained value was then subtracted from the heat of the reaction to obtain the effective heat of binding [27]. DSC Heat denaturation measurements were carried out on a MicroCal ... a conformational change The temperature dependence of the partial molar heat capacity of free NarJ or NarJT differed considerably from that of their complexes with Na...
Ngày tải lên: 16/02/2014, 14:20
Tài liệu Báo cáo khoa học: An autoinhibitory effect of the homothorax domain of Meis2 ppt
... other Meis paralogs, may play a role in regulating transcriptional activity, but it appears that the Hth domain does not maintain the cytoplasmic localization of Prep1. Additionally, the greatest ... if interaction of Pbx1 with the Hth domain altered the conformation or intramolecular interactions, allowing access to the AD. As the autoinhibition affected an unrelated AD whe...
Ngày tải lên: 16/02/2014, 15:20
Tài liệu Báo cáo khoa học: Perturbation of membranes by the amyloid b-peptide – a molecular dynamics study pptx
... order parameters of each leaflet separately, including the whole acyl chain and the ‘plateau region’ described above. Taking the approach applied by Bachar and Becker [18], we analyzed the lipids ... set A. After making contact with the DPPC headgroups (within 10 ns in all cases), the N-terminal segment of Ab attracts the lipids of the top leaflet, depressing their lateral ar...
Ngày tải lên: 18/02/2014, 08:20