Báo cáo khoa học: "BabelNet: Building a Very Large Multilingual Semantic Network" docx

... Sanda M. Harabagiu, Dan Moldovan, Marius Pas¸ca, Rada Mihalcea, Mihai Surdeanu, Razvan Bunescu, Roxana Girju, Vasile Rus, and Paul Morarescu. 2000. FALCON: Boosting knowledge for answer engines. ... 2010. c 2010 Association for Computational Linguistics BabelNet: Building a Very Large Multilingual Semantic Network Roberto Navigli Dipartimento di Informatica Sapienza Universit `...

Ngày tải lên: 30/03/2014, 21:20

... driver weapon meal compartment croatian defect refugee delay Table 2: Grammatical Pattern Comparison Our seeds are one word (such as "car") and its plural. We do not claim that all single ... gen- erally a good property, such invariant metrics can lead to bad results when used with sparse data. In particular, if a part word p has occurred only once in the data in the AB...

Ngày tải lên: 20/02/2014, 19:20

... program metallel based on Fass' program meta5 (Fass [1988]). Metallel's lexicon is written as a series of sense frames, each containing information about a particular word sense. A ... which it occurs and add it to the path. Not all paths are valid, indicating that some criteria of acceptability are needed during analysis. In addition, paths that are superficially diff...

Ngày tải lên: 17/03/2014, 08:20

... were classified as those causing an increase in patient monitoring, a change in vital signs but without associated harm or a need for treatment or increased length of stay. Major errors were categorised ... director, according to an adapted scale [9-11]. Minor errors were classified as those causing no harm or an increase in patient monitoring with no change in vital signs and no harm not...

Ngày tải lên: 25/10/2012, 10:39

... substantia nigra is a neuropathological hallmark of Parkinson’s disease. This leads to a decreased level of dopamine in the striatum. As a result, synaptic transmission is nega- tively affected ... jbc.M110.177246. 24 Doi H, Okamura K, Bauer PO, Furukawa Y, Shimizu H, Kurosawa M, Machida Y, Miyazaki H, Mitsui K, Kuroiwa Y et al. (2008) RNA-binding protein TLS is a major nuclear aggreg...

Ngày tải lên: 14/02/2014, 19:20

... sequencing and mutational analysis of a gene cluster involved in nitrite reduction in Paracoccus denitrificans. Antonie Leeuwenhoek 66, 111–127. 13 Kawasaki S, Arai H, Kodama T & Igarashi Y (1997) Gene ... FEBS 23 Chang CK (1994) Heme d 1 and other heme cofactors from bacteria. Ciba Found Symp 180, 228–238. 24 Van Spanning RJ, Wancell CW, De Boer T, Hazelaar MJ, Anazawa H, Harms N, Oltma...

Ngày tải lên: 15/02/2014, 01:20

... red). Table 1. Average distances between CA atoms of the stefins and catalytic residues of cysteine proteases. Distance calculated d (A ˚ ) Papain–stefin B 23.93 Cathepsin H–stefin A 23.36 ± 0.23 Cathepsin ... Biochemistry and Molecular and Structural Biology, Jozef Stefan Institute, Jamova 39, SI-1000 Ljubljana, Slovenia Fax: +386 1 477 3984 Tel: +386 1 477 3215 E-mail: dusan.turk@ijs.si Dat...

Ngày tải lên: 18/02/2014, 04:20

... GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC cyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG cyc1-z GCATCAGAAAGCATAGGC cyc1-m TGGGAATACGATAGAGTAG nb2 primer GTTTAAACGAGCTCGAATTC Coq7 in fission yeast R. ... GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG Spcoq3-y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG Spcoq3-z GTATGCGATGTGGAATTTG Spcoq3-m GATGCCTTCCAATGAATTAC cyc1-w GAACCAATGAAATAAGGGCG cyc1-x...

Ngày tải lên: 18/02/2014, 14:20

... followed by PCR with Taq DNA polymerase (Promega, Madison, WT, USA) using the primers 5¢-CACACTACACTGGGAAGCAGAG ACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG- 3¢. The cDNA was subcloned into ... 5¢-AA GCTTCCGGAGGCTGCTAGAGAC-3¢ and 5¢-GGATC CAAGAACTGTGTATGTCTG-3¢. The 1.6-kbp full- length Skn cDNA, whose termination codon was changed to a BamHI site, was inserted between the SalI and ......

Ngày tải lên: 18/02/2014, 16:20

... 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter. The ... organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura, Nobuaki Yoshida and Hirotak...

Ngày tải lên: 18/02/2014, 17:20