Báo cáo khoa học: Development of a baculovirus-based fluorescence resonance energy transfer assay for measuring protein–protein interaction potx

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter. The ... Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from murine tissues....

Ngày tải lên: 18/02/2014, 17:20

11 874 0
Báo cáo khoa học: "Development of a Stemming Algorithm" pdf

Báo cáo khoa học: "Development of a Stemming Algorithm" pdf

... problem and of this report as a whole. After a word in the library user's query has been stemmed and a matching stem and associated list of full-word forms has been found in the catalogue and ... Form, and Meaning By its computational nature, a stemming algorithm has inherent limitations. The routine handles individual words: it has no access to information about their...

Ngày tải lên: 16/03/2014, 19:20

10 360 0
Báo cáo khoa học: Development of a baculovirus-based fluorescence resonance energy transfer assay for measuring protein–protein interaction potx

Báo cáo khoa học: Development of a baculovirus-based fluorescence resonance energy transfer assay for measuring protein–protein interaction potx

... Group, Research School of Biological Sciences, The Australian National University, Canberra, Australia A new baculovirus-based fluorescence resonance energy transfer (Bv-FRET) assay for measuring ... into the forward primer (5¢-CCTGTCAGATCTCCGCCAT GGCTAACAATGCATCTCT-3¢), and a BamHI site (bold) was introduced into the reverse primer (5¢-TCTCC CGGATCCAAAGAGAAATACCCATA-TA...

Ngày tải lên: 30/03/2014, 20:20

9 380 0
Báo cáo khoa học: Characterization of a Cry1Ac-receptor alkaline phosphatase in susceptible and resistant Heliothis virescens larvae potx

Báo cáo khoa học: Characterization of a Cry1Ac-receptor alkaline phosphatase in susceptible and resistant Heliothis virescens larvae potx

... (RCA-I) Galb1 fi 4GlcNAc 0.2 M Gal Gala1 fi 3Gal Dolichus biflorus (DBA) GalNAca1 fi 3GalNAc 0.2 M GalNAc GalNAca1 fi 3Gal Sophora japonica (SJA) Galb1 fi 3GalNAc 0.2 M Gal Galb1 fi 3,4GlcNAc Wistaria floribunda ... 3,4GlcNAc Wistaria floribunda (WFL) a/ bGalNAc 0.2 M GalNAc Helix pomatia (HPL) GalNAca1 fi 3GalNAc 0.2 M GalNAc GalNAca1 fi 3Gal Griffonia simplicifolia (GSL) GalNAca1 fi 3Gal 0.2 M Gal Gala...

Ngày tải lên: 23/03/2014, 13:20

9 400 0
Báo cáo khoa học: "Development of Computational Linguistics Research: a Challenge for Indonesia" pptx

Báo cáo khoa học: "Development of Computational Linguistics Research: a Challenge for Indonesia" pptx

... an important means as a way to understand the evolution of language usage by its people. In the case of Bahasa Indonesia, research activities on corpus analysis were almost none. There was one ... foreign words. Detailed analysis can be found in Muhadjir (1996). 2 KBBI (Kamus Besar Bahasa Indonesia), the standard word dictionary for Bahasa Indonesia, contains a little more than 7...

Ngày tải lên: 17/03/2014, 07:20

2 318 0
Báo cáo khoa học: Dynamics of a-synuclein aggregation and inhibition of pore-like oligomer development by b-synuclein doc

Báo cáo khoa học: Dynamics of a-synuclein aggregation and inhibition of pore-like oligomer development by b-synuclein doc

... University of California San Diego, La Jolla, CA, USA 4 Department of Pathology, University of California San Diego, La Jolla, CA, USA 5 Department of Medicine, University of California San Diego, La ... does not aggregate and reduces a- synuclein (a- syn)-related pathology. Although considerable information is available about the conformation of a- syn at the initial and end st...

Ngày tải lên: 23/03/2014, 09:21

16 284 0
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

... substantia nigra is a neuropathological hallmark of Parkinson’s disease. This leads to a decreased level of dopamine in the striatum. As a result, synaptic transmission is nega- tively affected ... [33,34]. The co-administration of antioxidants like coenzyme Q and creatine has also been shown to be beneficial against a- synuclein aggregation in the substantia nigra pars compacta...

Ngày tải lên: 14/02/2014, 19:20

11 754 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

... GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC cyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG cyc1-z GCATCAGAAAGCATAGGC cyc1-m TGGGAATACGATAGAGTAG nb2 primer GTTTAAACGAGCTCGAATTC Coq7 in fission yeast R. ... GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG Spcoq3-y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG Spcoq3-z GTATGCGATGTGGAATTTG Spcoq3-m GATGCCTTCCAATGAATTAC cyc1-w GAACCAATGAAATAAGGGCG cyc1-x...

Ngày tải lên: 18/02/2014, 14:20

16 646 0
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf

Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf

... Seligman PA & Allen RH (1978) Characterization of the receptor for transcobalamin II isolated from human placenta. J Biol Chem 253, 1766–1772. 22 Quadros EV, Nakayama Y & Sequeira JM (2005) ... plasmon resonance. Anal Biochem 305, 1–9. 16 Wuerges J, Garau G, Geremia S, Fedosov SN, Petersen TE & Randaccio L (2006) Structural basis for mamma- lian vitamin B 12 transport by t...

Ngày tải lên: 19/02/2014, 05:20

12 603 0
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... 5¢-CTTTAACTTGTTGGGCACTGG CATTG-3¢; NP6, 5¢-TTGATCGATTCTGTCTATGCCC CA-3¢ along with the adaptor primers: AP1 (5¢-GTAATAC GACTCACTATAGGGC-3¢) and AP2 (5¢-ACTATAGGG CACGCGTGGT-3¢). Nested PCR was carried ... PCR was performed in 50 lL containing 1 ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTP and dTTP, 0.2 lm of upstream primer (OP17: 5¢-GA AAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) and do...

Ngày tải lên: 19/02/2014, 07:20

14 524 0
w