Báo cáo khoa học: A 49 kDa microtubule cross-linking protein from Artemia franciscana is a coenzyme A-transferase pdf
Báo cáo khoa học: Molecular characterization of artemin and ferritin from Artemia franciscana pot
... 153–160. 10. Crack, J .A. , Mansour, M., Sun, Y. & MacRae, T.H. (2002) Functional analysis of a small heat shock /a- crystallin protein from Artemia franciscana: oligomerization and thermotolerance. Eur. ... Molecular characterization of artemin and ferritin from Artemia franciscana Tao Chen 1, *, Reinout Amons 2 , James S. Clegg 3 , Alden H. Warner 4 and Thomas H. MacRae 1...
Ngày tải lên: 23/03/2014, 20:22
Báo cáo khoa học: A 49 kDa microtubule cross-linking protein from Artemia franciscana is a coenzyme A-transferase pdf
... Drosophila that associated with microtubules, but to a lesser extent than did p49 from Artemia. Keywords: CoA-transferase; microtubule cross-linking pro- tein; Artemia franciscana. Cell shape and polarity ... et al. (Eur. J. Biochem. 270) Ó FEBS 2003 A 49 kDa microtubule cross-linking protein from Artemia franciscana is a coenzyme A- transferase Mindy M....
Ngày tải lên: 30/03/2014, 20:20
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx
... with available antisera [anti-51 kDa, anti-TYKY, anti-30 kDa, anti-18 kDa (NDUFB6)] failed to r eveal the presence of any c omplex I-specific subunits at that position. We believe that the band may ... separated by SDS/PAGE and BN/PAGE and trans- ferred t o I mmobilon-P (0.2 l) membranes. Anti-HA and anti-porin sera were used at 1 : 5000 dilution whereas the anti-MWFE and anti-18 kDa ser...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: The twin-arginine translocation (Tat) systems from Bacillus subtilis display a conserved mode of complex organization and similar substrate recognition requirements doc
... (CCAAACCACGTTTACTCACCTCAGCAGCCA ATACCG) for KR mutation; RKDmsAF (GCTGCTGAG GTGAGTCGCAAAGGTTTGGTAAAAACG) and RKD- msAR (CGTTTTTACCAAACCTTTGCGACTCACCTC AGCAGC) for RK mutation; and KRtoKKDmsAF (GCTGAGGTGAGTAAAAAGGGTTTGGTAAAAACG ACAGCG) ... KRtoKKDmsAF (GCTGAGGTGAGTAAAAAGGGTTTGGTAAAAACG ACAGCG) and KRtoKKDmsAR (CGCTGTCGTTT TTACCAAACCCTTTTTACTCACCTCAGC) for KK mutation. SDS/PAGE and western blot...
Ngày tải lên: 16/03/2014, 04:20
Báo cáo khoa học: Enzymatic oxidation of NADP+ to its 4-oxo derivative is a side-reaction displayed only by the adrenodoxin reductase type of ferredoxin-NADP+ reductases potx
... R Bernhardt (Universita ¨ t des Saarlandes, Saar- bru ¨ cken, Germany). NADP + , NADPH, NAD + and AMP were purchased from Sigma-Aldrich (Milano, Italy). Amplex Red was from Invitrogen. All other ... Discussion NADPO isolation, quantitation, and spectral characterization In order to study the kinetics of NADP + oxidation to NADPO catalyzed by FprA, an NADPO assay method was required. After...
Ngày tải lên: 16/03/2014, 11:20
Tài liệu Báo cáo khoa học: Octaketide-producing type III polyketide synthase from Hypericum perforatum is expressed in dark glands accumulating hypericins pdf
... Hydrangea macrophylla CTAS (AB011468) Hydrangea macrophylla STCS (AF456445) Ruta graveolens ACS (AJ297788) Gerbera hybrida 2-PS (Z38097) Rheum palmatum ALS (AY517486) Plumbago indica PKS (AB259100) ... palmatum ALS (AY517486) Plumbago indica PKS (AB259100) Phalaenopsis sp. BBS (X79903) Bromheadia finlaysoniana BBS (AJ131830) Sorbus aucuparia BIS (DQ286036) Hypericum androsaemum BPS...
Ngày tải lên: 18/02/2014, 18:20
Báo cáo khoa học: Properties of purified gut trypsin from Helicoverpa zea, adapted to proteinase inhibitors pdf
... Ratio S/C (%) ZRRpNA 94 a 117 a 124 ZFRpNA 91 a 123 a 135 ZRpNA 58 a 44 a 76 BApNA 33 a 3.5 a 11 RpNA 13 a 14 a 106 Dietary protein 0.045 b 0.044 b 98 Azocasein 0.329 c 0.238 c 72 a Activity is ... diet To obtain gut proteases that were resistant to protease inhibitors, larvae were adapted to SKTI. Two populations of H. zea larvae were raised in parallel. One populat...
Ngày tải lên: 23/03/2014, 20:22
Báo cáo khoa học: Phosphorylation modulates the local conformation and self-aggregation ability of a peptide from the fourth tau microtubule-binding repeat pdf
... This study reveals that both tau peptides are capable of self-aggregation and that phosphorylation at Ser356 can modulate this process. Abbreviations AD, Alzheimer’s disease; PHF, paired helical ... Instrumentation Frontier, National Institute of Advanced Industrial Science and Technology, Ibaraki, Japan Post-translational phosphorylation serves as a control mechanism in a myriad of cellu...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: Mammalian 105 kDa heat shock family proteins suppress hydrogen peroxide-induced apoptosis through a p38 MAPK-dependent mitochondrial pathway in HeLa cells potx
... mitochondria Caspases are a family of cysteine aspartic acid protease that are central regulators of apoptosis and form a pro- teolytic cascade that results in the cleavage of distinct and vital proteins ... Ishihara K, Yamagishi N, Saito Y, Adachi H, Kobay- ashi Y, Sobue G, Ohtsuka K & Hatayama T (2003) Hsp105alpha suppresses the aggregation of truncated androgen receptor with expand...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: "Circadian pattern of activation of the medical emergency team in a teaching hospita"
... emergency responses and teams. A traditional cardiac arrest ('code blue') team is comprised of a cardiology fellow and coronary care nurse, as well as an intensive care fellow and nurse, and the receiving ... staff should be available on a 24-hour basis to assess and treat acutely ill hospital patients. Utilization of a MET system has been associated with a reduc- tion i...
Ngày tải lên: 25/10/2012, 10:45