Báo cáo khoa học: De novo RNA synthesis by a recombinant classical swine fever virus RNA-dependent RNA polymerase pot

Báo cáo khoa học: De novo RNA synthesis by a recombinant classical swine fever virus RNA-dependent RNA polymerase pot

Báo cáo khoa học: De novo RNA synthesis by a recombinant classical swine fever virus RNA-dependent RNA polymerase pot

... GTATACGAGGTTAGTTCATTC 5¢-UTRfor1 CTATACGAGGTTAGTTCATTC 5¢-UTRfor2 TTATACGAGGTTAGTTCATTC 5¢-UTRfor3 ATATACGAGGTTAGTTCATTC 5¢-UTRrev TAATACGACTCACTATAGGGTGCCATGAA CAG 5¢-UTRrev2 GTGCCATGAACAGCAGAGATTTTTATAC P1 ... GTGCCATGAACAGCAGAGATTTTTATAC P1 TAGCCATGCCCATAGTAGG P2 ATCAGGTCGTACTCCCATCAC 3¢-UTRfor TAATACGACTCACTATAGCGCGGGTAAC 3¢-UTRfor2 GCGCGGGTAACCCGGGATCTGAA 3¢-UTRrev GGGCCGTTAGGAAATTACCTTA...

Ngày tải lên: 30/03/2014, 20:20

10 471 0
Báo cáo khoa học: De novo synthesis, uptake and proteolytic processing of lipocalin-type prostaglandin D synthase, b-trace, in the kidneys pptx

Báo cáo khoa học: De novo synthesis, uptake and proteolytic processing of lipocalin-type prostaglandin D synthase, b-trace, in the kidneys pptx

... Acta 1436, 606–615. 3 Matsuoka T, Hirata M, Tanaka H, Takahashi Y, Murata T, Kabashima K, Sugimoto Y, Kobayashi T, Ushikubi F, Aze Y et al. (2000) Prostaglandin D2 as a mediator of allergic asthma. ... prostaglandin D synthase (beta-trace) in human heart and its accumulation in the coronary circulation of angina patients. Proc Natl Acad Sci USA 94, 14689–14694. 27 Mase M, Yamada K, Iwata A...

Ngày tải lên: 30/03/2014, 01:20

13 525 0
Báo cáo khoa học: Efficient ATP synthesis by thermophilic Bacillus FoF1-ATP synthase ppt

Báo cáo khoa học: Efficient ATP synthesis by thermophilic Bacillus FoF1-ATP synthase ppt

... Kinosita and Yoshida Laboratories for help and advice, and S. Takahashi and K. Sakamaki for encour- agement and laboratory management. This work was supported in part by a Grants-in-Aid for Specially Promoted ... (HB-550; Horiba, Kyoto, Japan) to be 170 nm (Fig. 2). ATP synthesis assay and data analysis ATP synthesis by TF o F 1 was monitored with a lucifer- ase assay, as previous...

Ngày tải lên: 22/03/2014, 16:20

8 280 0
Tài liệu Báo cáo khoa học: "Three BioNLP Tools Powered by a Biological Lexicon" doc

Tài liệu Báo cáo khoa học: "Three BioNLP Tools Powered by a Biological Lexicon" doc

... …” IL/NP IL-2/NN-BIOMED -/- 2/CD mediated/VVD IL-2-mediated/UNKNOWN IL/NP 2/CD IL-2/NN-BIOMED BioLexicon mediated/VVD mediate/VVP mediate/VV of/IN mediated/VVN -/- -/- mediated/VVN dictionary-based tagging of/IN Fig. 3 BLTagger example coverage 0 20 40 60 80 100 verb noun adjective adverb nominalization adjetivial adverbal Terminologies Derivational relations ... automatically e...

Ngày tải lên: 22/02/2014, 02:20

4 334 0
Báo cáo khoa học: Sherlock Holmes and the proteome ) a detective story Pier Giorgio Righetti1 and Egisto Boschetti2 potx

Báo cáo khoa học: Sherlock Holmes and the proteome ) a detective story Pier Giorgio Righetti1 and Egisto Boschetti2 potx

... results in a proteome of ‘normalized’ relative abun- dances, amenable to analysis by MS and any other analytical tool. Exam- ples are given of analysis of human urine and serum, as well as cell and tissue ... performance of a hexapeptide ligand library in capturing the ‘hidden proteome’ is illustrated and evaluated. This library, insolubilized on an organic polymer and available under t...

Ngày tải lên: 07/03/2014, 10:20

9 666 0
Báo cáo khoa học: cDNA cloning and characterization of a novel calmodulinlike protein from pearl oyster Pinctada fucata potx

Báo cáo khoa học: cDNA cloning and characterization of a novel calmodulinlike protein from pearl oyster Pinctada fucata potx

... PCR reaction was performed with a forward primer UPM (a mixture of primers 5¢-CTAATACGACTCACTATAGGGC AAGCAGTGGTAACAACGCAGAGT-3¢ and 5¢-CTAAT ACGACTCACTATAGGGC-3¢) and a reverse specific gene primer ... integrity of RNA was determined by fractionation on 1.2% formal- dehyde-denatured agarose gel and staining with ethidium bromide. The quantity of RNA was determined by measur- ing D...

Ngày tải lên: 16/03/2014, 23:20

12 375 0
Báo cáo khoa học: "The Best of Both Worlds – A Graph-based Completion Model for Transition-based Parsers" pot

Báo cáo khoa học: "The Best of Both Worlds – A Graph-based Completion Model for Transition-based Parsers" pot

... for Natural Language Processing {bohnet,jonas}@ims.uni-stuttgart .de Abstract Transition-based dependency parsers are often forced to make attachment deci- sions at a point when only partial infor- mation ... in the beam are recalculated based on a scoring model inspired by the graph-based parsing ap- proach, i.e., taking complete factors into account as they become incrementally avail...

Ngày tải lên: 17/03/2014, 22:20

11 353 0
Báo cáo khoa học: 9-Deazaguanine derivatives connected by a linker to difluoromethylene phosphonic acid are slow-binding picomolar inhibitors of trimeric purine nucleoside phosphorylase potx

Báo cáo khoa học: 9-Deazaguanine derivatives connected by a linker to difluoromethylene phosphonic acid are slow-binding picomolar inhibitors of trimeric purine nucleoside phosphorylase potx

... nucleoside phosphorylase Katarzyna Breer 1 , Ljubica Glavas ˇ -Obrovac 2 , Mirjana Suver 2 , Sadao Hikishima 3 , Mariko Hashimoto 3 , Tsutomu Yokomatsu 3 , Beata Wielgus-Kutrowska 1 , Lucyna Magnowska 1 and Agnieszka ... Nucleo- sides Nucleotides 18, 759–771. 10 Hikishima S, Hashimoto M, Magnowska L, Bzowska A & Yokomatsu T (2007) Synthesis and biological evalua- tion of 9-deazaguanin...

Ngày tải lên: 29/03/2014, 08:20

14 368 0
Tài liệu Báo cáo khoa học: Interruption of triacylglycerol synthesis in the endoplasmic reticulum is the initiating event for saturated fatty acid-induced lipotoxicity in liver cells pdf

Tài liệu Báo cáo khoa học: Interruption of triacylglycerol synthesis in the endoplasmic reticulum is the initiating event for saturated fatty acid-induced lipotoxicity in liver cells pdf

... inhibit thapsigargin-induced Ctrl 3 h 12 h 24 h 36 h 6 h OA OA SA/OA SA/OA SA/OA SA/OA SA/OA SA OA FL1-Log Counts OA OA SA SA SA SA Ctrl Ctrl Ctrl Ctrl Ctrl SA OA SA/OA A B Fig. 5. Stearate (SA) supplementation ... unsaturated FFAs into the cells. After their internalization, FFAs are converted to fatty acyl-CoA, a reaction catalyzed by ACS. Fatty acyl-CoAs are acti- vated forms of fatt...

Ngày tải lên: 14/02/2014, 22:20

12 722 0
w