Báo cáo khoa học: Preparation and characterization of geodin A bc-crystallin-type protein from a sponge pot

Báo cáo khoa học: Preparation and characterization of geodin A bc-crystallin-type protein from a sponge pot

Báo cáo khoa học: Preparation and characterization of geodin A bc-crystallin-type protein from a sponge pot

... 1035 Preparation and characterization of geodin A bc-crystallin-type protein from a sponge Concetta Giancola 1 , Elio Pizzo 2 , Antimo Di Maro 3 , Maria Vittoria Cubellis 2 and Giuseppe D’Alessio 2 1 ... 575–599. 36 Barone G, Del Vecchio P, Fessas D, Giancola C & Graziano G (1993) THESEUS: a new software package for the handling and analysis of thermal denatu...

Ngày tải lên: 30/03/2014, 15:20

13 442 0
Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt

Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt

... reverse) 35¢-CTTAT(C ⁄ G)AACAAGGAA (A ⁄ C)AATTTC-3¢ PsCBL (degenerate forward) 45¢-GTATCAGCTTC(C ⁄ T)TCAAATGTC-3¢ PsCBL (degenerate reverse) 55¢-CCATCACAAGAAACTAGAGAAAC-3 PsCIPK (5¢UTR forward) 65¢-TTAAGTACTATAAAT-ACACAGCCTA-3¢ ... Remarks 15¢-GG (A ⁄ T)CA (A ⁄ C)GG (A ⁄ T)AC (A ⁄ C)TT(C ⁄ T)GC(C ⁄ G ⁄ T)AAGGT-3¢ PsCIPK (degenerate forward) 25¢-ACAAA (A ⁄ C )A( A ⁄ G) (A ⁄ G ⁄ T )A( C...

Ngày tải lên: 19/02/2014, 07:20

19 707 0
Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

... within the last 30 years. The greatest number of RIPs have been found in the Caryophyllaceae, Sambucaceae, Cucurbitaceae, Euphorbiaceae, Phytolaccaceae and Poaceae [1]. Although many are potentially ... Roberts 3 and Ana Paula U. Arau ´ jo 1,2 1 Programa de Po ´ s-graduac a o em Gene ´ tica e Evoluc a o, Universidade Federal de Sa˜o Carlos, Brazil 2 Instituto de Fı ´ sica de Sa˜o Carlos...

Ngày tải lên: 18/02/2014, 16:20

12 763 0
Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt

Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt

... rounds and tested for tyrosinase activity with a plate assay. In the assay plates, Trichoderma minimal med- ium [19] with 2% lactose as a carbon source, 1% potassium phthalate as a buffering agent ... fungal tyrosinases, from both a structural and a functional point of view, are from Agaricus bisporus [10] and N. crassa [1]. Also, a few bacterial tyrosinases have been...

Ngày tải lên: 19/02/2014, 06:20

14 651 0
Tài liệu Báo cáo khóa học: Cloning and characterization of two distinct isoforms of rainbow trout heat shock factor 1 ppt

Tài liệu Báo cáo khóa học: Cloning and characterization of two distinct isoforms of rainbow trout heat shock factor 1 ppt

... follows: HSF 1a forward, 5¢-GAAGCAGCTTGTCCAGTACACCAA-3¢; HSF 1a reverse, 5¢-TTCCAAGAGCTGAACAAACCATTG-3¢; HSF1b forward, 5¢-GAAGCAGCTGGTCCAGTACAC CTC-3¢; HSF1b reverse, 5¢-GGCTGAATAAACCATGC CAGTAGC-3¢; ... translations was analysed as a negative control (lanes 1 and 4), and vectors encoding epitope-tagged b-galactosidase (HA-bgal or Protein C-bgal) were translated in vitro as positiv...

Ngày tải lên: 19/02/2014, 12:20

10 539 0
Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf

Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf

... inves- tigation because of their physiological importance and their pharmaceutical relevance as drug carriers [1–6]. Both transporters catalyse the uptake of most dipep- tides and tripeptides and a variety ... was inhibited not only by unlabeled Bip-Pro itself, but also by well known sub- strates of H + ⁄ peptide cotransporters, such as Gly-Sar, Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-...

Ngày tải lên: 07/03/2014, 05:20

10 490 0
Báo cáo khoa học: Engineering and characterization of human manganese superoxide dismutase mutants with high activity and low product inhibition potx

Báo cáo khoa học: Engineering and characterization of human manganese superoxide dismutase mutants with high activity and low product inhibition potx

... library of protein variants based on the Q14 3A hMnSOD template. One hundred and fifty thousand QC774 transformants were screened on 40 M63 minimal media agar plates containing 1 lm paraquat for each ... of Illinois at Urbana-Champaign, Urbana, IL, USA 2 Department of Pharmacology and Biochemistry, University of Florida, Gainesville, FL, USA 3 Department of Neuroscience, Unive...

Ngày tải lên: 07/03/2014, 11:20

9 416 0
Báo cáo khoa học: Cloning and characterization of the genes encoding toxic lectins in mistletoe (Viscum album L) pot

Báo cáo khoa học: Cloning and characterization of the genes encoding toxic lectins in mistletoe (Viscum album L) pot

... and XhoI ML3p A- chain 5¢- GATATA CATATG TACCGTCGTATTAGCCTTCGTGTCACGGAT -3¢ 5¢- CACAC GAATTC TTATTAAGAAGAAGAAGAACGGTCCCTGCATAC -3¢ NdeI and EcoRI ML3.1p A- chain 5¢- GATATA CATATG TACGAGCGTCTTCGTCTTCGTGTTACGCATC -3¢ 5¢- CACAC GAATTC TTATTAAGAAGAAGAAGAACGGTCCCTGCATAC -3¢ NdeI ... and XhoI ML2p A- chain 5¢- GATATA CATATG TACGAGCGTCTTCGTCTTCGTGTTACGCATC -3¢ 5¢- CACAC CTCGAG TTATTAAGAAGA...

Ngày tải lên: 07/03/2014, 15:20

11 611 0
Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx

Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx

... is composed of 7 parallel b strands associated to an anti- parallel strand (b2) and is surrounded by 5 helices (a1 , a2 , a3 , a7 anda8). T he second domain c onsists of helices a4 , a5 and a6 a ll clustered ... and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family Ste ´ phane Ca...

Ngày tải lên: 07/03/2014, 16:20

9 584 0
Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc

Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc

... act as an NADH oxidase in vivo, instead act- ing as a CoADR. This is only the second demonstra- ted CoA reductase activity, and the first appearance of this activity in both the Archaea and in a ... concentration (as determined at 460 nm). blast and tfasta analysis of the phCoADR revealed a significant level of identity to putative NADH oxidases from hyperthermophiles and...

Ngày tải lên: 07/03/2014, 17:20

12 420 0
w