Báo cáo khoa học: Protein expressed by the ho2 gene of the cyanobacterium Synechocystis sp PCC 6803 is a true heme oxygenase pot
Báo cáo khoa học: Protein expressed by the ho2 gene of the cyanobacterium Synechocystis sp. PCC 6803 is a true heme oxygenase pot
... FEBS Protein expressed by the ho2 gene of the cyanobacterium Synechocystis sp. PCC 6803 is a true heme oxygenase Properties of the heme and enzyme complex Xuhong Zhang 1 , Catharina T. Migita 2 , ... Sato 3 , Masanao Sasahara 1 and Tadashi Yoshida 1 1 Department of Biochemistry, Yamagata University School of Medicine, Japan 2 Department of Biolog...
Ngày tải lên: 30/03/2014, 15:20
Báo cáo khoa học: Protein stabilization by compatible solutes Effect of diglycerol phosphate on the dynamics of Desulfovibrio gigas rubredoxin studied by NMR docx
... experimental error, an average value of 0.004 p.p.m., and a maximum value of 0.087 p.p.m. (Phe30). The displacement of 15 N chemical shifts follows a similar pattern, with an average value of 0.031 ... the average protein structure. Acknowledgements The SON large-scale facility at Utrecht is acknowledged for valuable support and the acquisition of several spectra. Th...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Cell type-specific transgene expression of the prion protein in Xenopus intermediate pituitary cells ppt
... containing EcoRI and XbaI restriction sites at their 5¢ ends (5¢-XPrP(DSS)-Eco RI: 5¢-GGG GGAATTCA AGAAGAG CGG TGGTGGG AA-3¢ and 3¢-XPrP(DSS)-XbaI: 5¢-GGGGTCTAGATCACTCTAT CACAAAGTAAACAAAGAGAGT-3¢, ... extraction and detection of prion proteins in mouse and hamster prion diseases by ELISA. J Pathol 199, 534–541. 51 Sachsamanoglou M, Paspaltsis I, Petrakis S, Verghese- Nikolakaki S, Panagio...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo khoa học: Site-directed mutagenesis and footprinting analysis of the interaction of the sunflower KNOX protein HAKN1 with DNA ppt
... using Pfu DNA polymerase and oligonucleotides MALN1: 5¢-GC GGAATTCAAAAAGAGAAAGAAAGGG-3¢ and MALC: 5¢-GGCCTGCAGCTAGAGAAGTGAAACATC-3¢ with HAKN1 cDNA [28] as the template. An I50S mutant was constructed ... FEBS Site-directed mutagenesis and footprinting analysis of the interaction of the sunflower KNOX protein HAKN1 with DNA Mariana F. Tioni, Ivana L. Viola, Raquel L. Chan and Danie...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Structure, mRNA expression and linkage mapping of the brain-type fatty acid-binding protein gene (fabp7 ) from zebrafish (Danio rerio) potx
... 5¢-GTACA TATTGTCGTTAGAACGCGTAATACGACTCACTA TAGGGA-3¢,3¢-CATGTATAACAGCAATCTTGCGC ATTATGCTGAGTGATATCCCTCTAG-5¢,usingT4 DNA ligase (Promega). Following precipitation, the DNA was resuspended in 15 lL of sterile, ... 0.915 tcaCCAAttga V$ECAT/NFY.01 nuclear factor Y )1203 (+) 1.000 0.937 aggacCCAAtaaggga V$GATA/GATA2.02 GATA-binding factor 2 )177 (–) 1.000 0.912 agcGATAtta V$GATA/GATA1.03 GATA...
Ngày tải lên: 31/03/2014, 07:20
Tài liệu Báo cáo khoa học: Complete subunit sequences, structure and evolution of the 6 · 6-mer hemocyanin from the common house centipede, Scutigera coleoptrata pptx
... form a common clade, as it may be assumed by the ÔTracheataÕ hypothesis [7,48,49]. As proposed by the ÔPancrustaceaÕ concept [50], there is a well-supported common branch of the crustacean and ... bp of the respective 5¢ untranslated regions and the entire 3¢ untranslated regions. The standard polyadenylation signals (AATAAA) and the poly (A) -tails of different...
Ngày tải lên: 20/02/2014, 11:20
Báo cáo khoa học: Substrate preference and phosphatidylinositol monophosphate inhibition of the catalytic domain of the Per-Arnt-Sim domain kinase PASKIN ppt
... awaits the identification of the endogenous stimulus of PASKIN catalytic activity. Autophosphorylation of recombinant PASKIN is activated by phospholipids A possible mechanism of PASKIN activation ... phosphorylated by PASKIN was further investigated. S6 is a target of the mammalian target of rapamycin (mTOR) signalling pathway that regulates nutrient-dependent p...
Ngày tải lên: 06/03/2014, 00:21
Báo cáo khoa học: Protein transport in organelles: Dual targeting of proteins to mitochondria and chloroplasts ppt
... mitochondria and a native chloroplast passenger protein was only tar- geted to chloroplasts [31]. By contrast, the dual target- ing signal of Arabidopsis asparaginyl-tRNA synthetase C. Carrie et al. Dual ... vivo. Analysis of the targeting ability of DNA polymerase c2 in another study revealed that it was dual targeted, but from a protein produced from the standard AUG [...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Substrate specificity and transport mode of the proton-dependent amino acid transporter mPAT2 potx
... 3. Apparent K m and V max of various amino acids as a function of the membrane potential in PAT2 expressing oocytes. Membrane potential dependency of the apparent K m (A) and V max (B) values of b-alanine ... and betaine, and the D -enantiomers of serine and alanine. The apparent affinities of PAT1 substrates are mainly in the range of 2–15 m M [1,2,4,6,9]. As shown...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: "Linguistically Motivated Features for Enhanced Back-of-the-Book Indexing" ppt
... vo- cabulary of plausible keyphrases, usually in the form of a list of subject headings or a domain specific thesaurus. The use of a vocabulary has the addi- tional benefit of eliminating the extraction ... j are the row and column indices of the 934 contingency table. The O counts are the cells of the table. The E counts are calculated from the margina...
Ngày tải lên: 08/03/2014, 01:20