Báo cáo khoa học: An asymmetric ion channel derived from gramicidin A Synthesis, function and NMR structure ppt

Báo cáo khoa học: An asymmetric ion channel derived from gramicidin A Synthesis, function and NMR structure ppt

Báo cáo khoa học: An asymmetric ion channel derived from gramicidin A Synthesis, function and NMR structure ppt

... chain A, and 1, 3, 5, 7, and 9 for chain B); and those between aH i and NH i-6 (i ¼ 10 and 8 for chain A, and 14, 12, 10, and 8 for chain B). These two types of long-range NOE reflect a right-handed single-stranded ... & Sutherland T (2003) Ion channels from linear and branched bola- amphiphiles. J Org Chem 68, 1050–1058. 10 Yoshino N, Satake A & Kobuke Y (200...

Ngày tải lên: 30/03/2014, 15:20

12 446 0
Báo cáo khoa học: An unusual plant triterpene synthase with predominant a-amyrin-producing activity identified by characterizing oxidosqualene cyclases from Malus · domestica ppt

Báo cáo khoa học: An unusual plant triterpene synthase with predominant a-amyrin-producing activity identified by characterizing oxidosqualene cyclases from Malus · domestica ppt

... 5¢-CTCTCTTAGTATCTGAAAACGCCATAGG AG-3¢; MdOSC2 forward, 5¢-CGCAGATGGTGGCAATG ATCCATACATC-3¢; MdOSC2 reverse, 5¢-TGAAGTTCT TCTCCCTTAAGAACTGCATTC-3¢; MdOSC3 forward, 5¢-GCAATCGTGATCAAAGAAGATGTGGAGG-3¢; and MdOSC3 ... control and a mixture of a- amyrin and b-amyrin as standard. MS fragmentations of peaks A and B (lower panel) were identical to those of authentic a- amyrin and b-am...

Ngày tải lên: 14/03/2014, 23:20

15 467 0
Báo cáo khoa học: "An Exploration of Forest-to-String Translation: Does Translation Help or Hurt Parsing?" ppt

Báo cáo khoa học: "An Exploration of Forest-to-String Translation: Does Translation Help or Hurt Parsing?" ppt

... trees, any of which the decoder can use to generate a translation. Previous work has shown that an observed target- language translation can improve parsing of source- language text (Burkett and ... context and data that the trans- lation model happens to capture. Finally, we varied the size of the parallel text (keeping a maximum rule height of 5 and the largest language model)...

Ngày tải lên: 30/03/2014, 17:20

5 299 0
Báo cáo khoa học: "An Unsupervised Vector Approach to Biomedical Term Disambiguation: Integrating UMLS and Medline" ppt

Báo cáo khoa học: "An Unsupervised Vector Approach to Biomedical Term Disambiguation: Integrating UMLS and Medline" ppt

... second-order bigrams with a Log Likelihood Ratio greater than 3.84 and the exact and gap cluster stopping param- eters (Purandare and Pedersen, 2004; Kulkarni and Pedersen, 2005). 4 Our Approach Our approach ... differ- ent semantic and syntactic structures. Some such information includes related concepts and semantic types. A semantic type (ST) is a broad subject cat- egori...

Ngày tải lên: 31/03/2014, 00:20

6 215 0
Báo cáo khoa học: An ‘Old World’ scorpion b-toxin that recognizes both insect and mammalian sodium channels A possible link towards diversification of b-toxins ppt

Báo cáo khoa học: An ‘Old World’ scorpion b-toxin that recognizes both insect and mammalian sodium channels A possible link towards diversification of b-toxins ppt

... was also purchased from Latoxan (LTx-003; Valance, France) together with the anti-mam- malian a- toxin, Lqh2. Purification and analysis of Lqhb1 Toxin purification was carried out by conventional ... WorldÕ. Experimental procedures Biological material Venom from Leiurus quinquestriatus hebraeus was collected from scorpion stings to a parafilm membrane. Sarcophaga falculata (blowfly) la...

Ngày tải lên: 31/03/2014, 01:20

8 391 0
Báo cáo khoa học: An Escherichia coli twin-arginine signal peptide switches between helical and unstructured conformations depending on the hydrophobicity of the environment potx

Báo cáo khoa học: An Escherichia coli twin-arginine signal peptide switches between helical and unstructured conformations depending on the hydrophobicity of the environment potx

... obtained from the PHD program (1 and 2) and final configurations from an MD simulation in water (3 and 4); the twin-arginine motif has been depicted using a space-filling representation. 3350 M. San Miguel ... method with thermostat and barostat relax- ation constants of 0.5 and 1.0, respectively, and a timestep of 2 fs. The peptide and TFE were modelled with the CHARMM p...

Ngày tải lên: 31/03/2014, 07:20

8 330 0
Tài liệu Báo cáo khoa học: Novel aspects of heat shock factors: DNA recognition, chromatin modulation and gene expression ppt

Tài liệu Báo cáo khoa học: Novel aspects of heat shock factors: DNA recognition, chromatin modulation and gene expression ppt

... Interestingly, Saccharomyces HSF is unu- sual among transcriptional activators because it can bypass a need for critical general transcription factors and co-activators, including general transcription fac- tor ... and deacetylase modulate chroma- tin structure and fine-tune transcription [58]. The his- tone chaperones Asf1, Spt6 and Spt16 are involved in histone eviction and red...

Ngày tải lên: 18/02/2014, 04:20

10 565 0
Tài liệu Báo cáo khoa học: Comparative studies of endonuclease I from cold-adapted Vibrio salmonicida and mesophilic Vibrio cholerae docx

Tài liệu Báo cáo khoa học: Comparative studies of endonuclease I from cold-adapted Vibrio salmonicida and mesophilic Vibrio cholerae docx

... GCTTTTAAAGTTGACTTCAAAG 2 CTTTGAAGTCAACTTTAAAAGC 3 CTA CCATGGCACCTCCTTCTTCTTTCTCAA 4 GCT GTCGACTTATTTAGTGCATGCTTTATAAACAA 5 CTA CCATGGCCCCCATCTCTTTTAGTCAT 6 GCT GTCGACTCAGTTCGGGCATTGCTCAC B. Altermark ... and the mean values are drawn. AB Fig. 8. Cleavage of plasmid, dsDNA and ssDNA. (A) 14 nM VcEndA incubated at 23 °C for 5 min with plasmid (lane 2), dsDNA (lane 4) and ssDNA (lane 6). S...

Ngày tải lên: 19/02/2014, 05:20

12 565 0
Tài liệu Báo cáo khoa học: Transcription of individual tRNA1Gly genes from within a multigene family is regulated by transcription factor TFIIIB pdf

Tài liệu Báo cáo khoa học: Transcription of individual tRNA1Gly genes from within a multigene family is regulated by transcription factor TFIIIB pdf

... which the TATATAA sequence was mutated to GATATCA (lanes 5 and 6, 10 and 100·, respectively). Regulation of pol III transcription A. Parthasarthy and K. P. Gopinathan 5194 FEBS Journal 272 (2005) ... phosphocellulose fractions, PC-B and PC-C as well as with the heparin–Sepharose fractions. The reactions were maximally active at 6 lg of both PC-B and PC-C (Fig. 2B; lane 4) and at...

Ngày tải lên: 20/02/2014, 02:21

15 484 0
Tài liệu Báo cáo khoa học: "Toward finer-grained sentiment identification in product reviews through linguistic and ontological analyses" ppt

Tài liệu Báo cáo khoa học: "Toward finer-grained sentiment identification in product reviews through linguistic and ontological analyses" ppt

... in- formation around extracted adjective or verbs by the patterns based on POS information. 5 Statistical Analysis and Discussion We conducted one-way Analysis of Variance (ANOVA) tests using relevance ... conceptual granularity we regarded all the attributes with a depth less than 2 as ‘coarse’ and those more than 2 as ‘fine’. Syntactic and lexical clues are identified from t...

Ngày tải lên: 20/02/2014, 09:20

4 337 0
w