Báo cáo khoa học: Natural-abundance isotope ratio mass spectrometry as a means of evaluating carbon redistribution during glucose–citrate cofermentation by Lactococcus lactis potx

... Natural-abundance isotope ratio mass spectrometry as a means of evaluating carbon redistribution during glucose–citrate cofermentation by Lactococcus lactis Mohamed Mahmoud, Emmanuel Gentil and ... mass spectrometry; lactic acid bacteria; m etabolic regulation; pyruvate. A r ange of simple sug ars can be c atabolized anaerobically by Lactoc occus...

Ngày tải lên: 30/03/2014, 15:20

... 1B) are consistent with an octasaccharide of compo- sition Hex 5 HexNAc 3 . The approximate relative proportions of partially methylated alditol acetates (PMAAs) from methylation analysis (Table ... Linkage and monosaccharide composition assignment from methylation analysis of milk oligosaccharides. PMAA, partially methylated alditol acetate. Molar ratios are relative to 1,5-di-O-acetyl...

Ngày tải lên: 19/02/2014, 12:20

... recruits an ADP-ribosylation factor 6 guanine nucleotide exchange factor (such as ARNO) to the apical plasma mem- brane. ARNO facilitates ADP-ribosylation factor 6 activation at the apical membrane, ... the particular case of HXA 3 , its stimulated production and release from the apical surface of infected intestinal epithelial cells provides an unprecedented pathway of regulated acti...

Ngày tải lên: 19/02/2014, 02:20

... Proceedings of the 47th Annual Meeting of the ACL and the 4th IJCNLP of the AFNLP, pages 333–341, Suntec, Singapore, 2-7 August 2009. c 2009 ACL and AFNLP Phrase-Based Statistical Machine Translation as ... we will propose an alternative. This alternative is based on the observation that phrase-based decoding can be very naturally cast as a Traveling Salesman Prob- lem (TSP), one...

Ngày tải lên: 20/02/2014, 07:20

... evaluation measure separately (by only using the rewards given for that particular measure), and a policy based on a combination (sum) of the rewards for all evalu- ation measures. We found that the learned ... effectiveness of a strategy depends on many different factors, such as classification/ASR performance, the dialogue domain and task, and, perhaps most importantly, personal...

Ngày tải lên: 20/02/2014, 12:20

... germ-cell development and germ-cell malignancy. Nature 460, 909–913. 89 Hong H, Takahashi K, Ichisaka T, Aoi T, Kanagawa O, Nakagawa M, Okita K & Yamanaka S (2009) Suppression of induced pluripotent ... hematopoietic com- partment using a CD34 + hESC-derived starting popu- lation has been considered as a potential AIDS therapy, and as a way to alleviate secondary effects produ...

Ngày tải lên: 22/03/2014, 17:20

... the plasma mem- brane early after receptor ligation whereas the cell death regulators FAS-associated via death domain (FADD) and caspase 8 are recruited to a pro-apopto- tic complex that forms ... NEMO adaptor bridges the nuclear factor-kappaB and interferon regulatory factor signaling pathways. Nat Immunol 8, 592–600. 73 Ashida H, Kim M, Schmidt-Supprian M, Ma A, Ogawa M & Sasakawa C...

Ngày tải lên: 28/03/2014, 23:20

... horse- shoe crab antimicrobial peptides. J Biol Chem 276, 27166–27170. 26 Kawabata S, Nagayama R, Hirata M, Shigenaga T, Agarwala KL, Saito T, Cho J, Nakajima H, Takagi T & Iwanaga S (1996) Tachycitin, ... was first identi- fied as a stimulator that led to the release of histamine from rat mast cells [33]. Mastoparan forms an amphi- philic a- helix, and its carboxyl terminus is amida...

Ngày tải lên: 30/03/2014, 20:20

... physician paternalism into the surrogate decision-making equation is ethically unacceptable. Most rational surrogates are unwilling to continue life support after a reasonable trial has demonstrated ... suspended animation; they are not alive in the sense the we enjoy life but neither are they able to die as long as nutrition, hydration, ventilation, and perfusion are assured. In many c...

Ngày tải lên: 25/10/2012, 10:45

... AYRAAYTCRWRBCCYTTCCA RPE6 5a- Fwd NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAG RPE6 5a ... human RPE65, RPE65c or GFP as a negative control at a MOI of 100. The isomerohydrolase activity assay was carried out as described previously [17]....

Ngày tải lên: 14/02/2014, 14:20