Báo cáo khoa học: Expression in yeast of a novel phospholipase A1 cDNA from Arabidopsis thaliana docx
Báo cáo khoa học: Expression in yeast of a novel phospholipase A1 cDNA from Arabidopsis thaliana docx
... 337 TATATAGGTACCTTATGCATCAACAGAGACACTTAC 338 ATATATGGATCCATGGGCTGGATTCCGTGTCCGTGCTGGGGAACC 353 AACGACGATGAAAACGCCGGCGAGGTGGCGGATCGTGATCCGGTG CTTCTAGTATCTGGAATTGGAGGCTCTATTCTGCATTCTAAGAAGA AGAATTCAAAGTCTGAAATTCGGGTTTG TATATAGGTACCTTAACCAGAATCAACTACTTTGTG ... 353 AACGACGATGAAAACGCCGGCGAGGTGGCGGATCGTGATCCGGTG CTTCTAGTATCTGGAATTGGAGGCTCTATTCTGCATTCTAAGAAGA AGAATTCAAAGTCTGAAATTCGGGTTTG TATATAGGTAC...
Ngày tải lên: 30/03/2014, 15:20
Báo cáo khoa học: Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana pptx
... l-amino acids such as amino acid oxidases, transaminases, and racemases (epimerases). For example, in pea seedlings the occurrence of d-amino acid aminotransferase was demonstrated [36]. For a ... value, and safety of d-amino acids. Adv Exp Med Biol 289, 447– 481. 39 Lohmann KN, Gan S, John MC & Amasino RM (1994) Molecular analysis of natural leaf senescence in Arabidopsis...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Expression and characterization of recombinant 2¢,5¢-oligoadenylate synthetase from the marine sponge Geodia cydonium ppt
... Molinaro RJ, Jha BK, Malathi K, Varambally S, Chin- naiyan AM & Silverman RH (2006) Selection and clo- ning of poly (rC) -binding protein 2 and Raf kinase inhibitor protein RNA activators of ... discovered as a part of the interferon antiviral pathway in mammals [1,2]. In higher animals (vertebrates), when activated by dsRNA, 2- 5A synthetases catalyze the polymerization of...
Ngày tải lên: 23/03/2014, 09:20
Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx
... l-amino acids, including l-aspartate, l-glutamine, l-alanine, l-arginine, l-cysteine, l-proline, l-phenylalanine, l-lysine, l-tryptophan, l-isoleucine, l-tyrosine, l-histi- dine, l-leucine, l-valine, ... similarity with (putative) TDHs and zinc-containing alcohol de- hydrogenases from archaea and bacteria. Some of the most significant hits of a BLAST search analysis were a TDH from...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf
... Seiichiro Ikeda 1 , Shinya Kajita 1 , Masaya Nakamura 2 and Yoshihiro Katayama 1 1 Graduate School of Bio-Applications and Systems Engineering, Tokyo University of Agriculture and Technology, Koganei, ... not attack b-aryl ether linkages in high-molecular mass mate- rials in vivo because it acts at the intramolecular level and cannot gain access to the b-aryl ether linkages in high-...
Ngày tải lên: 17/03/2014, 03:20
Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf
... clea- vage fragments (horizontal double arrows, A1 A5 ) in the sequence of insulin chain A. (B) Change over time in the chromatographic peak area of cleavage fragments. Note that the amount of frag- ments ... metallo-endoprotease of Serratia marcescens (serralysin), are the alkaline protei- nase of Pseudomonas aeruginosa, the ZapA metallo- protease of Proteus mirabilis and...
Ngày tải lên: 23/03/2014, 09:20
Báo cáo khoa học: The human pyridoxal kinase, a plausible target for ginkgotoxin from Ginkgo biloba docx
... 5 min (a) and 60 min (b) with alkaline phosphase (Merck, Darmstadt, Germany; 100 U) at 37°C, as analyzed by HPLC. This material is available as part of the online article from http://www.blackwell-synergy.com Please ... show that the inhibitory effect of ginkgotoxin and DPN on PLP for- mation can be alleviated by increasing amounts of PL. In the case of PL coincubated with ginkgo...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: Expression and characterization of cyanobacterium heme oxygenase, a key enzyme in the phycobilin synthesis Properties of the heme complex of recombinant active enzyme potx
... and 10. The pK a value of this acid–base transition is estimated based on the increase of absorbance at 418 nm as pH increases. Curve fitting of the fraction of thealkaline form to the calculated ... reductase was also examined. As illustrated in Fig. 8, the obtained spectra are clearly discriminated from those of the ascorbate- supported reaction. Although addition of 14 equ...
Ngày tải lên: 23/03/2014, 20:22
Báo cáo khoa học: Expression profile of PIN, AUX ⁄ LAX and PGP auxin transporter gene families in Sorghum bicolor under phytohormone and abiotic stress pot
... organization in Arabidopsis tha- liana [30]. In addition, AUX1 and LAX3 are involved in auxin–ethylene interactions during apical hook development in Arabidopsis seedlings [31]. P-Glycoprotein ... PIN: data on AtPIN and OsPIN families (Tables S3 and S4) is based on TAIR annotation and Wang et al. [18]. (B) LAX: Inventory of the AtLAX and OsLAX family is based on TAIR and TIGR ri...
Ngày tải lên: 29/03/2014, 09:20
Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt
... China Introduction Ischaemic heart disease is a life-threatening condition that may cause sudden cardiac failure and death. Many researchers have investigated cell transplantation as an alternative treatment ... cardiac fibrosis in a paracrine manner under ischaemic conditions. Taken together, these findings may improve understanding of the cellu- lar and molecular basis of the anti -...
Ngày tải lên: 18/02/2014, 04:20