0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Mode of action of the microbial metabolite GE23077, a novel potent and selective inhibitor of bacterial RNA polymerase docx

Báo cáo khoa học: Mode of action of the microbial metabolite GE23077, a novel potent and selective inhibitor of bacterial RNA polymerase docx

Báo cáo khoa học: Mode of action of the microbial metabolite GE23077, a novel potent and selective inhibitor of bacterial RNA polymerase docx

... Mode of action of the microbial metabolite GE23077, a novel potent and selective inhibitor of bacterial RNA polymerase Edoardo Sarubbià, Federica Monti*, Emiliana Corti, Anna Miele and Enrico ... fromrifampicin, the data shown in the previous paragraphsindicate that the two compounds share a number of common features. Both are potent and selective inhibitors of bacterial RNAPs (Table 1) and ... SelvaVicuron Pharmaceuticals, Gerenzano, Varese, Italy GE23077, a novel microbial metabolite r ecently isolatedfrom Actinomadura sp. culture media, is a potent and selective inhibitor of bacterial...
  • 9
  • 339
  • 0
Báo cáo khoa học: Growth hormone/JAK-STAT axis signal-transduction defect A novel treatable cause of growth failure pdf

Báo cáo khoa học: Growth hormone/JAK-STAT axis signal-transduction defect A novel treatable cause of growth failure pdf

... ReverseTranscription System (Thermoscrip RT, Invitrogen).Human GHR was amplified from cDNA with primersACACTCAAGAATGGACTCAAG and TGTAAATTGGCTCATCTGAG under the following conditions: denatura-tion at ... cycles.Cloning of p21WAF/CIPI and transfectionsHuman p21WAF ⁄ CIPIcDNA derived from the C childrenwas amplified using the following primers: GGAAATCATGTCAGAACCGGC and CTAGCTAGCTTAGGGCTTCCTCTTGGA. Subsequently, ... Diaz2, Dimitris Kletsas3, Efthimia K. Basdra4,Theodore K. Alexandrides5, Zvi Zadik6, Stuart J. Frank7, Vassiliki Papathanassopoulou1,Nicholas G. Beratis1, Athanasios G. Papavassiliou2and...
  • 13
  • 323
  • 0
Báo cáo khoa học: Adenylyl cyclase Rv0386 from Mycobacterium tuberculosis H37Rv uses a novel mode for substrate selection ppt

Báo cáo khoa học: Adenylyl cyclase Rv0386 from Mycobacterium tuberculosis H37Rv uses a novel mode for substrate selection ppt

... basis of the availablestructural data of canonical mammalian class IIIa and mycobacterial class IIIc catalytic domains [5,7,9,25]nor do they parallel the findings on the noncanonicalclass IIIc AC ... purified and stable in the absence of proteaseinhibitors. Actually, none of the previously reportedmutants of the canonical lysine-aspartate couple inmammalian and mycobacterial ACs appeared to ... has a glutamine-asparagine pair at the positions defining ATP as a sub-strate instead of the lysine-aspartate consensus. Weshow that the purified catalytic domain of Rv0386 isactive as an AC...
  • 8
  • 401
  • 0
Tài liệu Báo cáo khoa học: Specific interaction between the classical swine fever virus NS5B protein and the viral genome pdf

Tài liệu Báo cáo khoa học: Specific interaction between the classical swine fever virus NS5B protein and the viral genome pdf

... +RNA0+RNA1 +RNA2 +RNA3 +RNA4 +RNA5 C– RNA1 RNA2 RNA3 RNA4 RNA5 CGGCC +RNA1 CGGC +RNA2 CGG +RNA3 C +RNA4 +RNA5 ACCTCGTATAC RNA0 ACCTCGTATA RNA1 ACCTC RNA2 ACC RNA3 AC RNA4 RNA5 Fig. 4. Map ping of ... rotein and the +RNA0 (Fig. 2B). In t hesame way, the E MSA containing a fixed a mount of the NS5B and the radiolabeled RNA0 in the presence of increasing amounts of c ompetitor, the unlabeled RNA0 also ... RNA replicon, in which the plus-strand RNA was more abundant than the minus-strand RNA [33].These results agree with the fact that the HCV RNA- dependent RNA polymerase replicates in vitro the...
  • 9
  • 560
  • 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... NA TGCARRAAYATHTTYTCCAGDeg RPE65-Rev AYRAAYTCRWRBCCYTTCCARPE6 5a- FwdNM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACACRPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAGRPE65c-FwdNM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE65c-Rev ... GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. Takahashi et al. A novel isomerohydrolase in the retinaFEBS Journal 278 (2011) ... CTGAGGTTACAGACAACTGTTC13cIMH GSP-Rev CCTTTGACATCGCAAGTGGATCARPE65c GSP-FwdNM_001113653 TTGAGGTGACAGACAATTGCCTRPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653...
  • 14
  • 753
  • 0
Tài liệu Báo cáo khoa học: Branched N-glycans regulate the biological functions of integrins and cadherins doc

Tài liệu Báo cáo khoa học: Branched N-glycans regulate the biological functions of integrins and cadherins doc

... b-1,6-GlcNAcbranched tri-antennary and tetra-antennary oligosac-charides in a 5b1[56]. Similarly, characterization of the carbohydrate moieties in a 3b1from nonmetastatic and metastatic human melanoma cell ... M, YamaguchiN, Kangawa K & Taniguchi N (1993) Purification and characterization of UDP-N-acetylglucosamine: alpha-6-D-mannoside beta 1-6N-acetylglucosaminyltransferase(N-acetylglucosaminyltransferase ... Noda K, Higashiyama S, IharaH, Matsuura N, Hayashi N, Kawata S, Matsuzawa Y& Taniguchi N (2001) The addition of bisecting N-acet-ylglucosamine residues to E-cadherin down-regulates the tyrosine...
  • 10
  • 477
  • 0
Tài liệu Báo cáo khoa học: Chemical approaches to mapping the function of post-translational modifications ppt

Tài liệu Báo cáo khoa học: Chemical approaches to mapping the function of post-translational modifications ppt

... vivoevolution of a tRNA synthetase–tRNA pair fromMethanococcus jannaschii capable of accepting and loading glycosylated amino acids has allowed the introduction of O-b-d-GlcNAc-l-Ser [25] and O -a- d-GalNAc-l-Thr ... withstanding these clear demonstrations of the utility of linear ligation assembly, a convergent chemo- selective approach can offer the key advantages of more ready and flexible modification of a well-definedprotein ... alsoprovided the first example of multisite -selective glyco-sylation with the same glycan and the coupling of a ABFig. 3. (A) The use of a thiol ‘tag and modify’ strategy allowed site -selective attachment...
  • 11
  • 682
  • 1
Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

... by the electrical potentialacross the membrane) and occasionally bind to and thus compensate the negative charge on the rotor. The freed positive charge on the stator attracts the nextnegative ... hasonly 10 membrane-buried negative charges that areessential for binding the ion and also for the rotationalmechanism of the ring. The c ring of I. tartaricus has11 negative charges that ... a bacterial ATP synthase raised the question whether the stoichiometry of V0:F0-likesubunits may be flexible and thus a mechanism tochange the action of the enzyme from ATP synthaseto ATPase....
  • 9
  • 773
  • 0
Tài liệu Báo cáo khoa học: Bone morphogenetic proteins in the early development of zebrafish pptx

Tài liệu Báo cáo khoa học: Bone morphogenetic proteins in the early development of zebrafish pptx

... (R-Smads, Smad1, -2, -3, -5 and -8), which,upon phosphorylation, are activated and bind to a common mediator Smad (Co-Smad, Smad4). The complexes move into the nucleus and act asregulators of ... zebra-fish was also shown to possess Chordin cleavageactivity [26]. The transcripts are detected throughout the early gastrula stage embryo but toward the end of gastrulation, the accumulation of ... throughout the embryo at a basal level (Fig. 2), whereas smad1 transcripts areonly detected from 80% epiboly. As sbn and swr[17], and sbn and snh [5], interact genetically, the bmp2b and bmp7 signals...
  • 8
  • 845
  • 0
Tài liệu Báo cáo khoa học: High affinity copper binding by stefin B (cystatin B) and its role in the inhibition of amyloid fibrillation docx

Tài liệu Báo cáo khoa học: High affinity copper binding by stefin B (cystatin B) and its role in the inhibition of amyloid fibrillation docx

... mutant of the variant atboth pH 7 and pH 5. Each panel is a plot of heat change on ligand addition (kcalÆmole)1)against the ligand ⁄ stefin molar ratio for one of the proteins analysed. The ... applied on a Formvar and carbon coatedgrid. After 5 min the sample was soaked away and stainedwith 1% (v ⁄ v) uranyl acetate. Samples were observed with a Philips (Amsterdam, the Netherlands) CM ... generated or absorbed as the ligand-macromolecule reaction occured. A binding isothermwas fitted to the data, expressed in terms of the heat changeper mole of ligand against the ligand to macromoleculeratio....
  • 14
  • 586
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP