Báo cáo khoa học: Mediator is required for activated transcription in a Schizosaccharomyces pombe in vitro system potx
... Gal4-CTF is able to activate basal transcription (Fig. 5E, compare lanes 1, 2, and 3) whereas Gal4-SP1 is not (compare lanes 1, 4, and 5). Antibodies against Srb4 inhibit activated but not basal transcription We ... human TFIIA can functionally replace Sc. pombe TFIIA in in vitro transcription assays. We do know that human TFIIA can stimulate the binding of Sc. pombe TBP t...
Ngày tải lên: 30/03/2014, 14:20
... Invitrogen (Carlsbad, CA, USA). Antise- rum against in uenza haemagglutinin (HA) was obtained from Sigma (St Louis, MO). The other antisera used were from our own collection. For phosphorimaging, a Storm 820 ... 5¢-GCGCGCGA ATTCATGAGCATTATTAAAGAATTTCG-3¢ (forward) and 5¢-CGCGCGGGATCCTTAAGCATAATCAGGAAC ATCATAAGGATAACCACCAGGAGAGCGGTTATTC TGCTCTTTC-3¢ (reverse). The EcoRI ⁄ BamHI-digested P...
Ngày tải lên: 07/03/2014, 02:20
... the relative increased character accuracy to the relat ive increased MAP for the three lexicon adaptation ap- proaches are different. A key factor making the proposed LAICA approach advantageous is ... Pat-tree-based keyword ex- traction for Chinese information retrieval. In SIGIR, pages 50–58. Sabine Deligne and Yoshinori Sagisaka. 2000. Sta- tistical language modeling with a cla...
Ngày tải lên: 20/02/2014, 07:20
Báo cáo khoa học: PSI1 is responsible for the stearic acid enrichment that is characteristic of phosphatidylinositol in yeast pdf
... contrast, PI from plants contains much more palmitic acid than stearic acid as the major (saturated) fatty acid; for example, 48% and 3%, respectively, in Arabidopsis thaliana [9]. Similarly, in yeast, ... cerevisiae that could catalyze such an activity, we performed a geno- mic database search, focusing our analysis on proteins belonging to the family of the glycerolipid acyltransfer...
Ngày tải lên: 29/03/2014, 22:21
Tài liệu Báo cáo khoa học: "The Software Architecture for the First Challenge on Generating Instructions in Virtual Environments" docx
... the Matchmaker; these then are stored in the database for later analysis. All of these components are implemented in Java. This allows the client to be portable across all major operating systems, ... or a playback function which displays an entire game run in real time. In summary, the GIVE Challenge is a novel evaluation effort for NLG systems. It is motivated by real ap...
Ngày tải lên: 22/02/2014, 02:20
Báo cáo khoa học: "Re-Ranking Models For Spoken Language Understanding Marco Dinarelli University of Trento Italy" potx
... 2007). In this approach, data are mapped into a vector space and SLU is performed as a classification problem using Maximal Margin Classifiers (Shawe-Taylor and Cristianini, 2004). Generative models ... Trento Italy riccardi@disi.unitn.it Abstract Spoken Language Understanding aims at mapping a natural language spoken sen- tence into a semantic representation. In the last decade t...
Ngày tải lên: 08/03/2014, 21:20
Báo cáo khoa học: "Distributed Word Clustering for Large Scale Class-Based Language Modeling in Machine Translation" docx
... wages Abby Abigail Agnes Alexandra Alice Amanda Amy Andrea Angela Ann Anna Anne Annette Becky Beth Betsy Bonnie Brenda Carla Carol Carole Caroline Carolyn Carrie Catherine Cathy Cheryl Christina ... Naomi Na- talie Nina Nora Norma Olivia Pam Pamela Patricia Patti Paula Pauline Peggy Phyllis Rachel Rebecca Regina Renee Rita Roberta Rosemary Sabrina Sally Samantha Sarah Selena Sheila Shelley .....
Ngày tải lên: 31/03/2014, 00:20
Báo cáo khoa học: "Weakly Supervised Learning for Cross-document Person Name Disambiguation Supported by Information Extraction" potx
... scoring scheme used in [Bagga & Baldwin 1998], which is believed to be an appropriate benchmarking standard for this task. Traditional benchmarking requires manually dividing person name ... is called singular vectors), and S is a diagonal matrix with the diagonal elements (called singular values) sorted decreasingly. The key idea of LSA is to reduce noise or insig...
Ngày tải lên: 31/03/2014, 03:20
Báo cáo khoa học: Expression and characterization of cyanobacterium heme oxygenase, a key enzyme in the phycobilin synthesis Properties of the heme complex of recombinant active enzyme potx
... remain at pH 10. This pH-dependent alteration is reversible between pH 6 and 10. The pK a value of this acid–base transition is estimated based on the increase of absorbance at 418 nm as pH increases. ... chloroplast genome of the redalga Porphyra purpurea. Plant Cell 5, 465–475. 35. Kaneko, T., Tanaka, A. , Sato, S., Kotani, H., Sazuka, T., Miyajima, N., Sugiura, M. & Tabata, S. (...
Ngày tải lên: 23/03/2014, 20:22
Báo cáo khoa học: Cytosol–mitochondria transfer of reducing equivalents by a lactate shuttle in heterotrophic Euglena docx
... determination L -lactate, pyruvate, ATP, L -malate, glutamate, and D -glucose were determined fluorometrically at 30 °C according to standard methods [16]. For D -lactate deter- mination, a large amount ... different preparations. Fig. 3. Intracellular concentrations of L -lactate and D -lactate in Euglena. (A) [ L -lactate]. (B) [ D -lactate]. Cultures with glutamate/malate (glu/mal) (j)...
Ngày tải lên: 30/03/2014, 20:20