Báo cáo khoa học: A novel four transmembrane spanning protein, CLP24 A hypoxically regulated cell junction protein pdf
Báo cáo khoa học: Role of peroxidase inhibition by insulin in the bovine thyroid cell proliferation mechanism pdf
... of peroxidase inhibition by insulin in the bovine thyroid cell proliferation mechanism Leo ´ n Krawiec 1 , Ramo ´ n A. Pizarro 2 , Paula Aphalo, Elena M. V. de Cavanagh 3 , Mario A. Pisarev 1,2,4 , Guillermo ... inhibition of cyclic AMP-dependent protein kinase and the disap- pearance of peroxidase inhibition by alkaline phosphatase and a- mannosidase in purified samples confirms its che...
Ngày tải lên: 30/03/2014, 14:20
Báo cáo khoa học: A novel four transmembrane spanning protein, CLP24 A hypoxically regulated cell junction protein pdf
... * Agtcgcccttctcagcgttccatcgatgcacacctgctatcgtggaacag cctagaaaccaagggactccaccaccaagtcacttcccctgctcgtgcag aggcacgggatgagtctgggtgacctctgcgccatgcgtgcgagacacgt gtgcgtttactgttatgtcggtcatatgtctgtacgtgtcgtgggccaac ctcgttctgcctccagctttcctggttagcgcaacgcggctccacgacca cacgcacttcagggtggaagctggaagctgagacacaggttaggtggcgc gaggctgccctgcgctccgctttgctttgggattaatttattctgcatct gctgagaggggcaccccagccatatcttacactttg...
Ngày tải lên: 30/03/2014, 14:20
Tài liệu Báo cáo khoa học: Two novel variants of human medium chain acyl-CoA dehydrogenase (MCAD) K364R, a folding mutation, and R256T, a catalytic-site mutation resulting in a well-folded but totally inactive protein pptx
... by site-directed PCR-based mutagenesis [12,30]. Mutagenic antisense oligonucleotides for MCAD 842GfiC(5¢-GAT AAAACCACACCTGTAGTAGCTG-3¢) and MCAD 116 5A G(5¢-CCTGTAGAAAGACTAATGAGGGATG CC-3¢) (mutagenic substitutions ... 548–556. 15 Ikeda Y, Okamura-Ikeda K & Tanaka K (1985) Purifi- cation and characterization of short-chain, medium- chain, and long-chain acyl-CoA dehydrogenases from rat l...
Ngày tải lên: 20/02/2014, 02:21
Báo cáo khoa học: Crystal structure determination and inhibition studies of a novel xylanase and a-amylase inhibitor protein (XAIP) from Scadoxus multiflorus pot
... approximately 50 kDa, a second peak of 30 kDa and a third peak of about 20 kDa. A similar gel filtration experiment was also carried out for the complex of XAIP with a- amylase. A mixture of XAIP and a- amylase ... interaction with a- amylase. Abbreviations BASI, barley a- amylase ⁄ subtilisin inhibitor; Con-B, concanavalin-B; GH, glycosyl hydrolase; TIM, triosephosphate isomerase;...
Ngày tải lên: 29/03/2014, 09:20
Báo cáo khoa học: Kinetic studies on endo-b-galactosidase by a novel colorimetric assay and synthesis of N -acetyllactosamine-repeating oligosaccharide b-glycosides using its transglycosylation activity pptx
... than that for keratan sulfate, indicating that 2 is very suitable as a sensitive sub- strate for analytical use in an endo-b-galactosidase assay. Compound 1 still acts as a fairly good substrate ... Sci. USA 75, 2315–2319. 33. Yamashita, K., Ohkura, T., Tachibana, Y., Takasaki, S. & Kobata, A. (1984) Comparative study of the oligosaccharides released from baby hamster kidney cells an...
Ngày tải lên: 31/03/2014, 07:20
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"
... you please elaborate on that specific situa- tion?' Data Analysis The qualitative analysis is based on a phenomenographic approach; that is a qualitative method to use empiric data (e.g., interview) ... of variation and bias in relation to monitoring of animal disease incidence on herd and national level, causal analysis on national level, as well as estimation of validated treatment...
Ngày tải lên: 25/10/2012, 10:45
Tài liệu Báo cáo khoa học: Evidence for noncooperative metal binding to the a domain of human metallothionein ppt
... proposal of MT as a potent antioxidant and anti- apoptotic protein. Experimental procedures Materials The chemicals used were: cadmium sulfate (Fisher Scientific, Ottawa, ON, Canada); ultrapure ... CA, USA); ammonium formate buffer (Ald- rich, Oakville, ON, Canada); isopropyl-b-d-thiogalactoside (Sigma-Aldrich, Oakville, ON, Canada); ammonium hydrox- ide (BDH Chemicals ⁄ VWR, Mississauga,...
Ngày tải lên: 19/02/2014, 00:20
Tài liệu Báo cáo khoa học: 1,5-Diamino-2-pentyne is both a substrate and inactivator of plant copper amine oxidases ppt
... characterization was prepared by a cyclic flux of D APY solution through a hydroxyapatite column (1 · 10 cm) containing immobilized GPAO and catalase. After GPAO (10 mkat) and catalase (10 mka ... 1,5-diamino-2-pentyne (DAPY). The unsymmetrical DAPY comprises both a propargyl and homopropargyl amine. DAPY was synthesized and tested as a substrate of two plant CAOs. DAPY acts as a mec...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Transcription of individual tRNA1Gly genes from within a multigene family is regulated by transcription factor TFIIIB pdf
... derivative of tRNA Gly 1 -1 has a single TATA ele- ment at )130 bp and is transcribed to the same levels as the parent. pmutRKX3 has the single TATATAA element of pRKX3 mutated to GATATCA. tRNA Gly 1 -6,7 ... individual tRNA Gly 1 genes from within a multigene family is regulated by transcription factor TFIIIB Akhila Parthasarthy and Karumathil P. Gopinathan Department of Microbiology a...
Ngày tải lên: 20/02/2014, 02:21
Tài liệu Báo cáo khoa học: "Discriminative Lexicon Adaptation for Improved Character Accuracy – A New Direction in Chinese Language Modeling" pptx
... increased character accuracy to the relat ive increased MAP for the three lexicon adaptation ap- proaches are different. A key factor making the proposed LAICA approach advantageous is that we ... parts randomly: 5K as the adaptation corpus and 5K as the testing set. We show the ASR char- acter accuracy results after lexicon adaptation by the proposed approach in Table 3. LAICA-1 LAICA-2 A...
Ngày tải lên: 20/02/2014, 07:20