Báo cáo khoa học: Human airway trypsin-like protease induces amphiregulin release through a mechanism involving protease-activated receptor-2-mediated ERK activation and TNF a-converting enzyme activity in airway epithelial cells doc
Báo cáo khoa học: Human airway trypsin-like protease induces amphiregulin release through a mechanism involving protease-activated receptor-2-mediated ERK activation and TNF a-converting enzyme activity in airway epithelial cells doc
... induces amphiregulin
release through a mechanism involving protease- activated
receptor-2-mediated ERK activation and TNF a- converting
enzyme activity in airway epithelial cells
Manabu Chokki, Hiroshi ... kinase activity.
Next, the involvement of AR in the HAT-induced
biphasic ERK activation was investigated using an anti-
AR neutralizing antibod...
Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt doc
... (2002)
Nuclear actin and actin-related proteins in chromatin
remodeling. Annu Rev Biochem 71, 755–781.
3 de la Serna IL, Ohkawa Y & Imbalzano AN (2006)
Chromatin remodelling in mammalian differentiation:
lessons ... Ulbrich A, Matsuda A, Reddy
VA, Orth A, Chanda SK, Batalov S & Joazeiro CA
(2008) Genome-wide and functional annotation of
human E3 ubiquitin ligases identifie...
Báo cáo khoa học: Human proteoglycan testican-1 inhibits the lysosomal cysteine protease cathepsin L pdf
... the
human testis [2], hence the name testican, and from human
vascular endothelial cells [3,4] and mouse brain [5]. In both
human and mouse, testican mRNA is prominent in brain
and absent in certain ... recent
findings that the p41 alternatively spliced variant of the
MHC invariant chain is not merely an inhibitor of
cathepsin L activity but also serves as a chaperone...
Tài liệu Báo cáo khoa học: Receptor binding characteristics of the endocrine disruptor bisphenol A for the human nuclear estrogen-related receptor c pptx
... the
originally high basal activation state in a dose-depen-
dent manner, and thus acts as an inverse antagonist of
ERRc.
ERRs are a subfamily of orphan NRs and are clo-
sely related to two ERs: ERa and ... for the basal constitutive activity, and the inverse antagonist activity of BPA (1 and
10 l
M) against the inverse agonist activity of 4-OHT (1 and 10 lM). The assa...
Tài liệu Báo cáo khoa học: Human Cdc45 is a proliferation-associated antigen pdf
... immunoreactivity
of a Cdc45-specific antibody on formalin-fixed and
paraffin-embedded tissues (Fig. 9). Antibodies against
PCNA and Cdc45 stained malignant cells in a compar-
able manner, e.g. on invasive-lobular ... 29,
577–580.
Supplementary material
The following supplementary material is available
online:
Fig. S1. Regulation of human Cdc45 protein during
terminal differentiatio...
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... ⁄ PDIP46 ⁄ SKAR(E) GCGGGATCCAACAAGGAAGAACCCCCC
ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC
pYESTrp2 ⁄ PDIP46
⁄ SKAR(F) GCGGGATCCCTGGACGGGCAGCCGATGAAG
ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT
pYESTrp2 ... AAACTGCAGGATGGCGGACATCTCCCTGGAC
AAACTGCAGAAGCTTGATTTTGAATTCTGT
pEGFP-N1 ⁄ PDIP46(2) ⁄ SKAR(b) AAACTGCAGGATGGCGGACATCTCCCTGGAC
AAACTGCAGAAGCTTGATTTTGAATTCTGT
pEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAA...
Tài liệu Báo cáo khoa học: Human intrinsic factor expressed in the plant Arabidopsis thaliana doc
... plants have a great potential
as a large-scale source of human IF for analytical and
therapeutic purposes.
Keywords: arabidopsis; cobalamin; intrinsic factor; recom-
binant.
Vitamin B
12
(cobalamin, ... Coomassie stained lanes: 1,
standards; 2, recombinant IF from plants.
PAS stained lanes: 3, standards; 4, recombin-
ant IF from plants; 5, recombinant IF from
yeast.
Ó FEBS 2003 Human...
Tài liệu Báo cáo khoa học: "Human Evaluation of a German Surface Realisation Ranker" docx
... not trained on enough
data.
Belz and Reiter (2006) carry out a comparison
of automatic evaluation metrics against human do-
main experts and human non-experts in the do-
main of weather forecast ... was
ignored in generation.
3
A ranking mechanism based on so-called optimality
marks can lead to a certain “asymmetry” between parsing and
generation in the sense that not...
Báo cáo khoa học: Human kynurenine aminotransferase II – reactivity with substrates and inhibitors potx
... transamination.
Abbreviations
AAD, a- aminoadipate; AlaAT, alanine aminotransferase; AspAT, aspartate aminotransferase; BCA, b-chloroalanine; CNS, central nervous
system; CSA, cysteine sulfinate; ESBA, (R)-2-amino-4-(4-(ethylsulfonyl))-4-oxobutanoic ... ⁄ a- aminoadipate (AAD)
aminotransferase; (c) KATIII ⁄ cysteine conjugate
b-lyase 2; (d) KATIV ⁄ glutamic-oxaloacetic transami-
nase 2 ⁄ mit...
Báo cáo khoa học: CD91 interacts with mannan-binding lectin (MBL) through the MBL-associated serine protease-binding site doc
... clusters and an 85 kDa beta-chain
involved in endocytosis and comprising the transmem-
brane and intracellular domains. Ligand interaction is
mediated by 31 homologus ligand-binding repeats dis-
tributed ... 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide,
N-hydroxysuccinimide and ethanolamine were from GE
Healthcare (Uppsala, Sweden).
Proteins
Human C1q, alpha 2-macroglobulin, BSA...