Báo cáo khoa học: Human airway trypsin-like protease induces amphiregulin release through a mechanism involving protease-activated receptor-2-mediated ERK activation and TNF a-converting enzyme activity in airway epithelial cells doc

Báo cáo khoa học: Human airway trypsin-like protease induces amphiregulin release through a mechanism involving protease-activated receptor-2-mediated ERK activation and TNF a-converting enzyme activity in airway epithelial cells doc

Báo cáo khoa học: Human airway trypsin-like protease induces amphiregulin release through a mechanism involving protease-activated receptor-2-mediated ERK activation and TNF a-converting enzyme activity in airway epithelial cells doc

... induces amphiregulin release through a mechanism involving protease- activated receptor-2-mediated ERK activation and TNF a- converting enzyme activity in airway epithelial cells Manabu Chokki, Hiroshi ... kinase activity. Next, the involvement of AR in the HAT-induced biphasic ERK activation was investigated using an anti- AR neutralizing antibod...

Ngày tải lên: 30/03/2014, 11:20

13 242 0
Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt doc

Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt doc

... (2002) Nuclear actin and actin-related proteins in chromatin remodeling. Annu Rev Biochem 71, 755–781. 3 de la Serna IL, Ohkawa Y & Imbalzano AN (2006) Chromatin remodelling in mammalian differentiation: lessons ... Ulbrich A, Matsuda A, Reddy VA, Orth A, Chanda SK, Batalov S & Joazeiro CA (2008) Genome-wide and functional annotation of human E3 ubiquitin ligases identifie...

Ngày tải lên: 06/03/2014, 09:22

12 432 0
Báo cáo khoa học: Human proteoglycan testican-1 inhibits the lysosomal cysteine protease cathepsin L pdf

Báo cáo khoa học: Human proteoglycan testican-1 inhibits the lysosomal cysteine protease cathepsin L pdf

... the human testis [2], hence the name testican, and from human vascular endothelial cells [3,4] and mouse brain [5]. In both human and mouse, testican mRNA is prominent in brain and absent in certain ... recent findings that the p41 alternatively spliced variant of the MHC invariant chain is not merely an inhibitor of cathepsin L activity but also serves as a chaperone...

Ngày tải lên: 17/03/2014, 10:20

8 175 0
Tài liệu Báo cáo khoa học: Receptor binding characteristics of the endocrine disruptor bisphenol A for the human nuclear estrogen-related receptor c pptx

Tài liệu Báo cáo khoa học: Receptor binding characteristics of the endocrine disruptor bisphenol A for the human nuclear estrogen-related receptor c pptx

... the originally high basal activation state in a dose-depen- dent manner, and thus acts as an inverse antagonist of ERRc. ERRs are a subfamily of orphan NRs and are clo- sely related to two ERs: ERa and ... for the basal constitutive activity, and the inverse antagonist activity of BPA (1 and 10 l M) against the inverse agonist activity of 4-OHT (1 and 10 lM). The assa...

Ngày tải lên: 18/02/2014, 16:20

12 583 0
Tài liệu Báo cáo khoa học: Human Cdc45 is a proliferation-associated antigen pdf

Tài liệu Báo cáo khoa học: Human Cdc45 is a proliferation-associated antigen pdf

... immunoreactivity of a Cdc45-specific antibody on formalin-fixed and paraffin-embedded tissues (Fig. 9). Antibodies against PCNA and Cdc45 stained malignant cells in a compar- able manner, e.g. on invasive-lobular ... 29, 577–580. Supplementary material The following supplementary material is available online: Fig. S1. Regulation of human Cdc45 protein during terminal differentiatio...

Ngày tải lên: 19/02/2014, 00:20

16 505 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

... ⁄ PDIP46 ⁄ SKAR(E) GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC pYESTrp2 ⁄ PDIP46 ⁄ SKAR(F) GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT pYESTrp2 ... AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT pEGFP-N1 ⁄ PDIP46(2) ⁄ SKAR(b) AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT pEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAA...

Ngày tải lên: 19/02/2014, 05:20

14 517 0
Tài liệu Báo cáo khoa học: Human intrinsic factor expressed in the plant Arabidopsis thaliana doc

Tài liệu Báo cáo khoa học: Human intrinsic factor expressed in the plant Arabidopsis thaliana doc

... plants have a great potential as a large-scale source of human IF for analytical and therapeutic purposes. Keywords: arabidopsis; cobalamin; intrinsic factor; recom- binant. Vitamin B 12 (cobalamin, ... Coomassie stained lanes: 1, standards; 2, recombinant IF from plants. PAS stained lanes: 3, standards; 4, recombin- ant IF from plants; 5, recombinant IF from yeast. Ó FEBS 2003 Human...

Ngày tải lên: 21/02/2014, 00:20

6 492 0
Tài liệu Báo cáo khoa học: "Human Evaluation of a German Surface Realisation Ranker" docx

Tài liệu Báo cáo khoa học: "Human Evaluation of a German Surface Realisation Ranker" docx

... not trained on enough data. Belz and Reiter (2006) carry out a comparison of automatic evaluation metrics against human do- main experts and human non-experts in the do- main of weather forecast ... was ignored in generation. 3 A ranking mechanism based on so-called optimality marks can lead to a certain “asymmetry” between parsing and generation in the sense that not...

Ngày tải lên: 22/02/2014, 02:20

9 480 0
Báo cáo khoa học: Human kynurenine aminotransferase II – reactivity with substrates and inhibitors potx

Báo cáo khoa học: Human kynurenine aminotransferase II – reactivity with substrates and inhibitors potx

... transamination. Abbreviations AAD, a- aminoadipate; AlaAT, alanine aminotransferase; AspAT, aspartate aminotransferase; BCA, b-chloroalanine; CNS, central nervous system; CSA, cysteine sulfinate; ESBA, (R)-2-amino-4-(4-(ethylsulfonyl))-4-oxobutanoic ... ⁄ a- aminoadipate (AAD) aminotransferase; (c) KATIII ⁄ cysteine conjugate b-lyase 2; (d) KATIV ⁄ glutamic-oxaloacetic transami- nase 2 ⁄ mit...

Ngày tải lên: 06/03/2014, 00:21

19 402 0
Báo cáo khoa học: CD91 interacts with mannan-binding lectin (MBL) through the MBL-associated serine protease-binding site doc

Báo cáo khoa học: CD91 interacts with mannan-binding lectin (MBL) through the MBL-associated serine protease-binding site doc

... clusters and an 85 kDa beta-chain involved in endocytosis and comprising the transmem- brane and intracellular domains. Ligand interaction is mediated by 31 homologus ligand-binding repeats dis- tributed ... 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide, N-hydroxysuccinimide and ethanolamine were from GE Healthcare (Uppsala, Sweden). Proteins Human C1q, alpha 2-macroglobulin, BSA...

Ngày tải lên: 06/03/2014, 01:23

9 344 0
w