Báo cáo khoa học: Neuropeptide S as a novel arousal promoting peptide transmitter pdf

Báo cáo khoa học: Neuropeptide S as a novel arousal promoting peptide transmitter pdf

Báo cáo khoa học: Neuropeptide S as a novel arousal promoting peptide transmitter pdf

... para- digms measuring responses to novelty or stress. These studies indicate that the NPS system is a newly discovered transmitter system that regulates vigilance and emotional states. NPS appears ... sleep onset and mainten- ance. Acetylcholine (ACh) appears to serve a dual role: ACh release coincides with elevated arousal as well as the onset of paradoxical sleep, also known as...

Ngày tải lên: 30/03/2014, 11:20

5 394 0
Báo cáo khoa học: "TAG''''s as a Grammatical Formalism for Ceneration" doc

Báo cáo khoa học: "TAG''''s as a Grammatical Formalism for Ceneration" doc

... developed as an al~ma~ive to the aandard tyntac~ formalisms that are ,,_~'~ in theoretical ~,.ll,/ ~s of languaSe. They are a. rwac~ve because they may pin,vide just the asFects of context seusit~ve ... program hu had to be of practical utility to the Imowedge based expert systems that use it as part of a natural language interface. This means that architecturally our...

Ngày tải lên: 24/03/2014, 02:20

10 505 0
Báo cáo khoa học: MNB⁄ DYRK1A as a multiple regulator of neuronal development pdf

Báo cáo khoa học: MNB⁄ DYRK1A as a multiple regulator of neuronal development pdf

... inhibitory site in response to hyperosmotic stress. Cell Signal 21, 1626–1633. 84 Kurabayashi N, Hirota T, Sakai M, Sanada K & Fuk- ada Y (2010) DYRK 1A and glycogen synthase kinase 3beta, a dual-kinase ... DS. Increased cell death is also associated with DS. For instance, cultured human cortical DS neurons exhibit intracellular oxidative stress and increased apoptosis [72]. Furthermor...

Ngày tải lên: 22/03/2014, 16:21

13 512 0
Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt

Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt

... another lysosomal storage disease) were shown to be folding and trafficking mutants [16] before this was explored as a possibility in GD. Galactose administration increased Q279E a- galactosidase A residual ... stabilize just one protein and thus are gener- ally protein and disease selective, if not specific. Many of the clinically important Fabry disease-asso- ciated a- galactosidase...

Ngày tải lên: 18/02/2014, 16:20

7 507 0
Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

... based on varying stabilities. Remarkably, we have found that, at least in some circumstances, a quanti- tative correlation to biophysical data can be obtained from a statistical analysis of selected ... libraries [15]. Here, the association of the variable heavy chain (V H )with protein A was used as a surrogate for direct stability measurements. The V H domains in camelid heavy cha...

Ngày tải lên: 19/02/2014, 12:20

7 502 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) ... defined), J lactate a las Þ¼0:919 Ãð129 À a las ÞÃð1 À e À6 a 2:1 las ÞÀ75:2 (Us er defined), J acetate a las Þ¼0:1135 ÃðÀ30:3 À a las ÞÃð1 À e À6 a 3:3 las Þþ 4:66 (User defined...

Ngày tải lên: 19/02/2014, 17:20

12 616 0
Tài liệu Báo cáo khoa học: "Sentence generation as a planning problem" pptx

Tài liệu Báo cáo khoa học: "Sentence generation as a planning problem" pptx

... STRIPS language (Fikes and Nils- son, 1971). In this paradigm, a planning state is defined as a finite set of ground atoms of predicate logic that are true in this state; all other atoms are as- sumed ... The task is to find a sequence of actions that moves us from the 337 initial state to a state that satisfies all the goals. In our case, the states are defined by the unfilled sub- sti...

Ngày tải lên: 20/02/2014, 12:20

8 339 0
Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

... discriminant analysis (LDA).Thisstatistical multivariate method is supervised. It searches for the variables containing the greatest interclass variance and the smallest intraclass variance, and constructs ... transform infrar ed spectroscopy for c lassification. Further analysis o f t he spectral differences indicated that discrimination between r esistant and sensitive cells was based o n var...

Ngày tải lên: 21/02/2014, 03:20

6 555 0
Tài liệu Báo cáo khoa học: "What''''s in a Semantic Network?" pptx

Tài liệu Báo cáo khoa học: "What''''s in a Semantic Network?" pptx

... major classes: objects, events, and relations. We consider each in turn. 2.1 Objects Objects include all conceivable physical objects as well as abstract objects such as ideas, numbers, ... language system is that it often has only partial information about the individuals (objects, events, and relations) that are talked about. Unless one assumes that the original linguistic an...

Ngày tải lên: 21/02/2014, 20:20

9 483 0
Báo cáo khoa học: 2-Pyrimidinone as a probe for studying the EcoRII DNA methyltransferase–substrate interaction docx

Báo cáo khoa học: 2-Pyrimidinone as a probe for studying the EcoRII DNA methyltransferase–substrate interaction docx

... 4-NH 2 group of the target cytosine is not essential for recognition of DNA by M.EcoRII as was suggested for several other MTases, as base flipping probably occurs with any base at the target position [26]. ... 2-Pyrimidinone as a probe for studying the Eco RII DNA methyltransferase–substrate interaction Oksana M. Subach 1 , Anton V. Khoroshaev 1 , Dmitrii N. Gerasimov 1 , Vladimir B....

Ngày tải lên: 07/03/2014, 15:20

9 437 0
Từ khóa:
w