Báo cáo khoa học: Neuropeptide S as a novel arousal promoting peptide transmitter pdf
Báo cáo khoa học: Neuropeptide S as a novel arousal promoting peptide transmitter pdf
... para-
digms measuring responses to novelty or stress. These studies indicate that
the NPS system is a newly discovered transmitter system that regulates
vigilance and emotional states. NPS appears ... sleep onset and mainten-
ance. Acetylcholine (ACh) appears to serve a dual role:
ACh release coincides with elevated arousal as well as
the onset of paradoxical sleep, also known as...
Báo cáo khoa học: "TAG''''s as a Grammatical Formalism for Ceneration" doc
...
developed as an al~ma~ive
to
the aandard tyntac~
formalisms that are
,,_~'~ in theoretical ~,.ll,/ ~s of languaSe.
They are a. rwac~ve because they may pin,vide just the
asFects of context seusit~ve ... program hu had
to be of practical utility to the Imowedge based expert
systems that use it as part of a natural language interface.
This
means
that architecturally our...
Báo cáo khoa học: MNB⁄ DYRK1A as a multiple regulator of neuronal development pdf
... inhibitory
site in response to hyperosmotic stress. Cell Signal 21,
1626–1633.
84 Kurabayashi N, Hirota T, Sakai M, Sanada K & Fuk-
ada Y (2010) DYRK 1A and glycogen synthase kinase
3beta, a dual-kinase ... DS.
Increased cell death is also associated with DS. For
instance, cultured human cortical DS neurons exhibit
intracellular oxidative stress and increased apoptosis
[72]. Furthermor...
Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt
... another
lysosomal storage disease) were shown to be folding
and trafficking mutants [16] before this was explored
as a possibility in GD. Galactose administration
increased Q279E a- galactosidase A residual ... stabilize just one protein and thus are gener-
ally protein and disease selective, if not specific.
Many of the clinically important Fabry disease-asso-
ciated a- galactosidase...
Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx
... based on varying stabilities. Remarkably, we
have found that, at least in some circumstances, a quanti-
tative correlation to biophysical data can be obtained from
a statistical analysis of selected ... libraries [15].
Here, the association of the variable heavy chain (V
H
)with
protein A was used as a surrogate for direct stability
measurements. The V
H
domains in camelid heavy cha...
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... CP-pyk
(5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT
GACANNNNNNNNNNNNNNTGRTATAATNNNNAA
GTAATAAAATATTCGGAGGAATTTTGAAATGAATA
AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk-
back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG
TC-3¢) ... defined),
J
lactate
a
las
Þ¼0:919 Ãð129 À a
las
ÞÃð1 À e
À6 a
2:1
las
ÞÀ75:2 (Us er
defined), J
acetate
a
las
Þ¼0:1135 ÃðÀ30:3 À a
las
ÞÃð1 À e
À6 a
3:3
las
Þþ
4:66 (User defined...
Tài liệu Báo cáo khoa học: "Sentence generation as a planning problem" pptx
... STRIPS language (Fikes and Nils-
son, 1971). In this paradigm, a planning state is
defined as a finite set of ground atoms of predicate
logic that are true in this state; all other atoms are as-
sumed ... The task is to
find a sequence of actions that moves us from the
337
initial state to a state that satisfies all the goals. In
our case, the states are defined by the unfilled sub-
sti...
Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc
... discriminant analysis (LDA).Thisstatistical
multivariate method is supervised. It searches for the
variables containing the greatest interclass variance and
the smallest intraclass variance, and constructs ... transform infrar ed spectroscopy for c lassification.
Further analysis o f t he spectral differences indicated that
discrimination between r esistant and sensitive cells was
based o n var...
Tài liệu Báo cáo khoa học: "What''''s in a Semantic Network?" pptx
...
major classes: objects, events, and relations. We consider
each in turn.
2.1 Objects
Objects include all conceivable physical objects as
well as abstract objects such as ideas, numbers, ... language system
is that it often has only partial information about the
individuals (objects, events, and relations) that are talked
about. Unless one assumes that the original linguistic
an...
Báo cáo khoa học: 2-Pyrimidinone as a probe for studying the EcoRII DNA methyltransferase–substrate interaction docx
... 4-NH
2
group of the target
cytosine is not essential for recognition of DNA by
M.EcoRII as was suggested for several other MTases, as
base flipping probably occurs with any base at the target
position [26]. ... 2-Pyrimidinone as a probe for studying the
Eco
RII DNA
methyltransferase–substrate interaction
Oksana M. Subach
1
, Anton V. Khoroshaev
1
, Dmitrii N. Gerasimov
1
, Vladimir B....
Từ khóa: