Báo cáo khoa học: Molecular analysis of the interaction between cardosin A and phospholipase Da Identification of RGD/KGE sequences as binding motifs for C2 domains pdf

Báo cáo khoa học: Molecular analysis of the interaction between cardosin A and phospholipase Da Identification of RGD/KGE sequences as binding motifs for C2 domains pdf

Báo cáo khoa học: Molecular analysis of the interaction between cardosin A and phospholipase Da Identification of RGD/KGE sequences as binding motifs for C2 domains pdf

... Taken together our results indicate that the C2 domain of plant phospholipase Da can act as a cardosin A- binding domain and suggest that plant C2 domains may have an additional role as RGD ⁄ KGE-recognition ... 38190–38196. Cardosin A associates with phospholipase Da I. Simo˜es et al. 5798 FEBS Journal 272 (2005) 5786–5798 ª 2005 FEBS Molecular analysis...

Ngày tải lên: 30/03/2014, 11:20

13 455 0
Báo cáo khoa học: Structural basis for the interaction between dynein light chain 1 and the glutamate channel homolog GRINL1A docx

Báo cáo khoa học: Structural basis for the interaction between dynein light chain 1 and the glutamate channel homolog GRINL1A docx

... 112, gal4D, gal80D, cyh r 2, LYS2::GAL1 UAS -HIS3 TATA -HIS3,MEL1; URA3::GAL1 UAS -GAL1 TATA -lacz) was used for all yeast two-hybrid assays. The pre-transformed MATCHMAKER library is a high-complexity ... plasma mem- brane of excitatory synapses, co-localizing with the NMDA receptors and close to proteins such as PSD- 95, nNOS, shank and GKAP. The fact that GRINL 1A may as...

Ngày tải lên: 29/03/2014, 09:20

11 474 0
Báo cáo khoa học: Proteome analysis at the level of subcellular structures Mathias Dreger pot

Báo cáo khoa học: Proteome analysis at the level of subcellular structures Mathias Dreger pot

... mass spectrometry along with the availability of comprehensive protein and DNA databases that made easy and quick protein identification feasible. The analytical tools that are available nowadays allow the identification ... biochemistry-oriented laboratories for dec- ades. The efficiency of the subcellular fractionation was assessed based on the determination of mark...

Ngày tải lên: 23/03/2014, 20:22

11 493 0
Báo cáo khoa học: NMR studies on the interaction of sugars with the C-terminal domain of an R-type lectin from the earthworm Lumbricus terrestris pot

Báo cáo khoa học: NMR studies on the interaction of sugars with the C-terminal domain of an R-type lectin from the earthworm Lumbricus terrestris pot

... observed; the chemical exchange for lactose and b-Me-Gal was in the slow exchange regime, whereas that for melibiose and a- Me-Gal, as anomers of lactose and b-Me-Gal, was in the intermediate exchange ... showing the chemical exchange for Asp18 or Trp33sc with increasing amounts of some sug- ars. Peak movements of main chain amide and amide proton of Asp18, a...

Ngày tải lên: 23/03/2014, 04:21

11 458 0
Báo cáo khoa học: UXT interacts with the transcriptional repressor protein EVI1 and suppresses cell transformation ppt

Báo cáo khoa học: UXT interacts with the transcriptional repressor protein EVI1 and suppresses cell transformation ppt

... Clones A1 to A3 7 ND Growth on SM -Trp ⁄ -Leu ⁄ -His ⁄ -Ala A1 , A6 , A7 , A1 0, A1 1, A1 4, A1 5, A1 7 A1 , A6 , A7 , A1 0, A1 4, A3 7 A2 0, A2 4, A2 5, A2 6, A2 9, A3 2, A3 3 A3 6, A3 7 b-galactosidase activity ND A1 , A6 , ... cell transformation. UXT has also been isolated as STAP1 and classified as a member of the a class prefoldin family [33]. UXT...

Ngày tải lên: 16/03/2014, 11:20

12 329 0
Báo cáo khoa học: An unusual plant triterpene synthase with predominant a-amyrin-producing activity identified by characterizing oxidosqualene cyclases from Malus · domestica ppt

Báo cáo khoa học: An unusual plant triterpene synthase with predominant a-amyrin-producing activity identified by characterizing oxidosqualene cyclases from Malus · domestica ppt

... 5¢-TGAAGTTCT TCTCCCTTAAGAACTGCATTC-3¢; MdOSC3 forward, 5¢-GCAATCGTGATCAAAGAAGATGTGGAGG-3¢; and MdOSC3 reverse, 5¢-TTCTCTTAAAATCTGAAAACGCC ATAGG-3¢. Amplification conditions included an initial denaturation ... vector as a negative control and a mixture of a- amyrin and b-amyrin as standards. Arrows indicate peaks with the same retention time as a- amyrin and b-amyrin st...

Ngày tải lên: 14/03/2014, 23:20

15 467 0
Báo cáo khoa học: Molecular cloning, expression analysis and functional confirmation of ecdysone receptor and ultraspiracle from the Colorado potato beetle Leptinotarsa decemlineata pdf

Báo cáo khoa học: Molecular cloning, expression analysis and functional confirmation of ecdysone receptor and ultraspiracle from the Colorado potato beetle Leptinotarsa decemlineata pdf

... (INT) and whole body (WB) at day 4 in the last larval instar, in the INT at day 0, 2, 4, 6 and 8 in the last larval instar, and in the adult male WB (#), female WB ($), testis TES and ovary (OVA), ... 4th instar development of L. decemlineata was constant until day 6 except for a small peak at day 4, and rapidly increased to the major peak between day 8 and day 9...

Ngày tải lên: 07/03/2014, 21:20

15 564 0
Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc

Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc

... 5¢-CG GGATCCCAATCTGTTGCTAA TTAGG-3¢)andthe3¢ specific oligonucleotides (5¢-GA AGATCTACCACACCTCCTCATCTCC-3¢) for ampli- fication of the region from )180 to )36 and (5¢-GA AGAT CTAACTAGATTTTACCATTGG-3¢) for amplification of the ... sequence analysis of the 35-bp region identified a DNA motif identical to the consensus DNA binding site (GGAAAA [37]), for a family of c...

Ngày tải lên: 08/03/2014, 10:20

10 475 0
Báo cáo khoa học: Molecular cloning and characterization of the crustacean hyperglycemic hormone cDNA from Litopenaeus schmitti Functional analysis by double-stranded RNA interference technique pot

Báo cáo khoa học: Molecular cloning and characterization of the crustacean hyperglycemic hormone cDNA from Litopenaeus schmitti Functional analysis by double-stranded RNA interference technique pot

... chloroform and once with chloroform, and RNA was precipitated with 2-propanol and dissolved in RNase-free water. Single-stranded RNAs were allowed to anneal by mixing equal amounts of each strand, ... been identified and can be divided into CHH -A and CHH-B groups [19]. In the crabs Can- cer pagurus, Carcinus maenas and Libinia emarginata and in the crayfishes Procambarus c...

Ngày tải lên: 23/03/2014, 10:20

9 486 0
Tài liệu Báo cáo khoa học: Molecular defect of isovaleryl-CoA dehydrogenase in the skunk mutant of silkworm, Bombyx mori ppt

Tài liệu Báo cáo khoa học: Molecular defect of isovaleryl-CoA dehydrogenase in the skunk mutant of silkworm, Bombyx mori ppt

... RT- PCR analysis revealed the BmIVD band amplified from whole-body RNA of standard strains p50T and c108T as well as the sku mutant. Migrations of the molecular mass marker and control gene rp49 are ... Koike Y, Nohata J, Kawasaki H, Kadono-Okuda K, Yamamoto K, Suzuki MG, Shimada T et al. (2003) The construction of an EST database for Bombyx mori and its applicati...

Ngày tải lên: 18/02/2014, 04:20

12 631 0
Từ khóa:
w