Báo cáo khoa học: Spectroscopic and DNA-binding characterization of the isolated heme-bound basic helix–loop–helix-PAS-A domain of neuronal PAS protein 2 (NPAS2), a transcription activator protein associated with circadian rhythms docx

Báo cáo khoa học: Spectroscopic and DNA-binding characterization of the isolated heme-bound basic helix–loop–helix-PAS-A domain of neuronal PAS protein 2 (NPAS2), a transcription activator protein associated with circadian rhythms docx

Báo cáo khoa học: Spectroscopic and DNA-binding characterization of the isolated heme-bound basic helix–loop–helix-PAS-A domain of neuronal PAS protein 2 (NPAS2), a transcription activator protein associated with circadian rhythms docx

... 25 39 Spectroscopic and DNA-binding characterization of the isolated heme-bound basic helix–loop–helix -PAS- A domain of neuronal PAS protein 2 (NPAS2), a transcription activator protein associated ... Fe(II) and Fe(II)–CO complexes of the bHLH -PAS- A domain of NPAS2 are shown in Y. Mukaiyama et al. Characterization of bHLH -PA...

Ngày tải lên: 30/03/2014, 11:20

12 360 0
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

... annotation of the DNA sequences flanking the Jannaschia sp. CCS1 HYD Js revealed an ORF encoding a putative allantoate amido- hydrolase, which is part of the urate catabolic pathway in many organisms ... (1988) Stereo- and substrate-specificity of a d-hydantoinase and a d-N-carbamyl amino acid amidohydrolase of Arthrobacter crystallopoietes AM 2. Enzyme Microb Technol 1...

Ngày tải lên: 18/02/2014, 08:20

14 621 0
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

... Surface area calculations for the pentamer give a total surface area of  81 000 A ˚ 2 with 30% ( 24 000 A ˚ 2 ) as con- tact area. Thus, a large amount of the available surface area of the molecule ... vector between the Kpn1 and Nco1 sites using a forward oligomer 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG...

Ngày tải lên: 19/02/2014, 06:20

10 648 0
Tài liệu Báo cáo khoa học: Molecular and biochemical characterization ofD-phosphoglycerate dehydrogenase fromEntamoeba histolytica A unique enteric protozoan parasite that possesses both phosphorylated and nonphosphorylated serine metabolic pathways docx

Tài liệu Báo cáo khoa học: Molecular and biochemical characterization ofD-phosphoglycerate dehydrogenase fromEntamoeba histolytica A unique enteric protozoan parasite that possesses both phosphorylated and nonphosphorylated serine metabolic pathways docx

... (5¢-caGGATCCaagatagttgtgataac cga-3¢ and 5¢-caCTCGAGttagaacttattgacttggaa-3¢), where capital letters indicate the BamHI or XhoI restriction sites. The PCR was performed with the following parameters: (a) ... EhPGDH (Arg217, Asp241 and Lys263), but Glu269 was substituted with an uncharged amino acid Thr245 (in E. histolytica), similarly to B. thetaiotaomicron PGDH (Ala253) and...

Ngày tải lên: 19/02/2014, 13:20

12 464 0
Tài liệu Báo cáo khoa học: Bioinformatic and enzymatic characterization of the MAPEG superfamily doc

Tài liệu Báo cáo khoa học: Bioinformatic and enzymatic characterization of the MAPEG superfamily doc

... primer, 5¢-GAGA GAGGATCCATATGACAAAAACCGAGTTAC-3¢, NdeI site; antisense primer, 5¢-GAGAGAAAGCTTCAAAACT GGGACAGTTG-3¢, HindIII site. The same method was used to amplify the coding sequence for the E.coliMGST, ... purification, functional characterization, and projection structure determination. J Biol Chem 27 8, 22 199 22 209. 23 Kaneko T, Sato S, Kotani H, Tanaka A, Asamizu E, Naka...

Ngày tải lên: 19/02/2014, 17:20

16 525 0
Tài liệu Báo cáo khoa học: Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani pdf

Tài liệu Báo cáo khoa học: Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani pdf

... characteristics of leishmania AK2 in comparison with its mammalian counterparts and its absolute need of the enzyme for growth and survival of the parasite within host macrophages are required to allow the ... of AK in maintenance and regeneration of intracellular ATP levels as shown in other organisms [7] partial reversal of antileishmanial action of Ap 5 A by A...

Ngày tải lên: 21/02/2014, 00:20

9 487 0
Tài liệu Báo cáo khoa học: Biochemical and molecular characterization of hazelnut (Corylus avellana) seed lipoxygenases pdf

Tài liệu Báo cáo khoa học: Biochemical and molecular characterization of hazelnut (Corylus avellana) seed lipoxygenases pdf

... region of the hazelnut LOX cDNA was amplified using the following primers: 5¢-AAGATGAAACGTG AGACGG-3¢ (CA1); 5¢-GATGACATCTCCATGGAA TAC-3¢ (CA2). The 3¢ region of the hazelnut LOX cDNA was amplified ... Hazelnut seeds contain reasonable levels of linoleic and linolenic acid (about 10 and 0 .2% , respectively, of the total fatty acids) and hexanal and nonanal are among...

Ngày tải lên: 21/02/2014, 00:20

11 404 0
Báo cáo khoa học: Kinetic and mechanistic characterization of Mycobacterium tuberculosis glutamyl–tRNA synthetase and determination of its oligomeric structure in solution pptx

Báo cáo khoa học: Kinetic and mechanistic characterization of Mycobacterium tuberculosis glutamyl–tRNA synthetase and determination of its oligomeric structure in solution pptx

... of the cognate tRNA (Eqn 2) . amino acid þ ATP $ aminoacyl-AMP + pyrophosphate ð1Þ amino acyl-AMP + tRNA aa $ AMP + aminoacyl tRNA aa 2 Most aaRS catalyse the formation of the aminoacyl- AMP ... the Institut Pasteur collection as the template in the presence of synthetic oligonucleotides pairs. Primer 1: 5¢-AAGAAGAAG CATATGTCACCGTGCCCG ACCAGCTG-3¢ Primer 2: 5¢-AAGAAGAAG...

Ngày tải lên: 07/03/2014, 03:20

20 497 0
Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx

Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx

... lac1 P LAC1F (5¢-AGCTTT CATTCCCAGTGATTG-3¢)andP LAC1R (5¢-AACGAG CTCAAGTACAAATGACT-3¢) were designed according to our cloned cDNA (GenBank Accession No. AY2490 52) . The PCR cycle programme was: ... egg stage (day 21 ), elongation stage (day 22 ), and mature fruiting body (day 23 ). The results of RT-PCR analysis of gene transcription in fungal mycelia grown on rice-straw and...

Ngày tải lên: 07/03/2014, 15:20

11 703 0
Báo cáo khoa học: Molecular and functional characterization of novel CRFR1 isoforms from the skin pptx

Báo cáo khoa học: Molecular and functional characterization of novel CRFR1 isoforms from the skin pptx

... P763 (5¢-TTCTCGAGACGCGTTATCGATAGAGAAATGT TCTGGC-3¢) and digested the PCR product with EcoRI and XhoI. The insert was synthesized with primers P764 (5¢-AACTCGAGGCTAGTCTGCAGGAGCTCAAGCT TTCTAGAGAATTCA-3¢)andP765(5¢-TGAATTCTC TAGAAAGCTTGAGCTCCTGCAGACTAGCCTCGA GTT-3¢). ... E3 and E18 (5¢-AC AAAGAAGCCCTGTACTGAATGGTCTCAG-3¢), and exons 13 and 14 by primers E16 (5¢-CATTCAGTAC AGGGCT...

Ngày tải lên: 07/03/2014, 15:20

10 671 0
w