Báo cáo khoa học: Oxygen binding properties of non-mammalian nerve globins doc

... 2006) doi:10.1111/j.1742-4658.2006.05158.x Oxygen- binding globins occur in the nervous systems of both invertebrates and vertebrates. While the function of invertebrate nerve haemoglobins as oxygen stores that extend ... temperature of pentacoordinate nerve Hbs of the annelid A. aculeata and the nemertean C. lacteus , of hexacoordinate nerve Hb of the bivalve mollusc...

Ngày tải lên: 30/03/2014, 11:20

... emphasize that Ca 2+ binding leads to further stabilization of the Mg 2+ -bound structure. We propose that at least one of the ion -binding sites of Calnuc is of the mixed Ca 2+ ⁄ Mg 2+ -binding type. Stains-all ... domains of the protein. We compared the Ca 2+ -binding and Mg 2+ -binding properties of Calnuc, and elucidated the physiological relevance of its interact...

Ngày tải lên: 07/03/2014, 00:20

... of the PPR motifs to the RNA -binding properties as the deletion of seven out of nine did not change the RNA -binding properties [41]. Defining the exact structure of the HCF152 homodimer together ... the specificity of binding to the target RNA sequence as well. Indeed, analyzing the PPR proteins of the Arabidopsis genome disclosed an average of 11 repetitions of this m...

Ngày tải lên: 17/03/2014, 10:20

... coupling of two dimers (Fig. 6A, substructure D 2 ), involving an interaction between eight oxygen- binding sites. This Table 2. Comparison of the goodness of fit of different oxygen- binding models. ... presence of presence of one (h ¼ 1) oxygenation-linked acid group and half (m ¼ 0.5) a Mg 2+ -binding site per oxygen- binding site. The 68.3% (i.e. one standard devi- a...

Ngày tải lên: 23/03/2014, 09:20

... The replacement of 316Glu with Ala had no effect on the binding ability of [ 3 H]BPA. All these results clearly indicate the crucial role of Arg316 for the ERRc receptor in ligand binding. This kind of structure–activity ... activity of 4-hydroxytamoxifen. However, the intrinsic binding mode of bisphenol A remains to be clarified. In the present study, we report the binding...

Ngày tải lên: 18/02/2014, 16:20

... mechanism of regulation of both domains involves a common iron dependent process [74,75,79]. Regulation of HIFa subunits by oxygen- dependent prolyl and asparaginyl hydroxylation A variety of oxygen ... docking site for VHL binding while hydroxyasparagine prevents binding of the coacti- vator p300. Finally, the long sought after links between oxygen availability and iron i...

Ngày tải lên: 20/02/2014, 23:20

... properties of various R258 mutants of deacetoxycephalosporin C synthase Hwei-Jen Lee 1 , Young-Fung Dai 1 , Chia-Yang Shiau 2 , Christopher J. Schofield 3 and Matthew D. Lloyd 4 1 Department of ... by nonhaem iron(II) and 2-oxoglutarate (2-OG)-dependent oxygenases [4]. Two of these enzymes, DAOCS and DACS, are part of a sequence-related subgroup of enzymes [8], which also include...

Ngày tải lên: 20/02/2014, 23:20

... the activator -binding domains of Swi1 and Snf5 of the yeast SWI ⁄ SNF chromatin remodeling complex has previously been characterized in vitro. Although deletion of both activator -binding domains ... regions of SWI ⁄ SNF cannot replace the recruiting function of the Swi1 and Snf5 activator -binding domains. The in vivo validation of the Swi1 and Snf5 activator-bind- ing domain...

Ngày tải lên: 07/03/2014, 00:20

... GCCGAATTCTCCTCAGCATGTCCAG (located upstream of hbpS and ending at the 5¢-end of binding site II) D IIEcofor CGAGAATTCGGGGGCGTCGGTCGC (located upstream of hbpS and beginning at the 3¢-end of binding site II) IIPstrev ... (located upstream of furS) IEcorev CGAGAATTCGAAAACGAACGGTGC (located upstream of furS and ending at the 5¢-end of binding site I) B IEcofor GTTGAATTCTCGTGT...

Ngày tải lên: 07/03/2014, 10:20

... FEBS concentration, the effect of the dimer/dodecamer equi- librium on the enzymatic properties of CDase I-5 was examined at various concentrations of KCl. First, the role of KCl in dissociation of CDase I-5 was ... presence of KCl. Considering also the 3D structure of CDase I-5, the analysis of the quaternary state of CDase I-5 revealed Fig. 8. Fluorescence spectra of C...

Ngày tải lên: 07/03/2014, 12:20