Báo cáo khoa học: Ca2+-binding allergens from olive pollen exhibit biochemical and immunological activity when expressed in stable transgenic Arabidopsis pdf

... recombin-ant allergens may offer the possibility of having available edible vaccines in the near future. In this study, two EF-hand-type Ca2+-binding allergens from olive pollen, Ole e 3 and ... clinical and scientiﬁc purposes, aswell as for developing new ways of vaccination.ResultsObtaining Arabidopsis transgenic plantscontaining Ole e 3 and Ole e 8 cDNAsBinary pROK2-OLEE3 and ... pollen exhibit biochemical and immunological activity when expressed in stable transgenic Arabidopsis Amalia Ledesma1, Vero´nica Moral2, Mayte Villalba1, Julio Salinas2 and Rosalı´a...

Báo cáo khoa học: Actin-binding domain of mouse plectin Crystal structure and binding to vimentin pot

... hand, doesn’t seem to be requiredfor actin-binding as calponin interacts with actin via itsC-terminal domain [51]. Thus, with an IF protein-bindingsite residing in their N-terminal CH domains ... (1995)Utrophin actin binding domain: analysis of actin binding and cellular targeting. J. Cell Sci. 108, 63–71.10. Gimona, M. & Winder, S.J. (1998) Single calponin homologydomains are not actin-binding ... domain. This additional amino-terminalintermediate ﬁlament protein binding site of plectin mayhave a function in intermediate ﬁlament dynamics and assembly, rather than in linking and stabilizing...

Tài liệu Báo cáo khoa học: "Portable Translator Capable of Recognizing Characters on Signboard and Menu Captured by Built-in Camera" docx

... useful information. These include destina-tions and notices in transportation facilities, namesof buildings and shops, explanations at sightseeingspots, and the names and prices of dishes in restau-rants. ... user speciﬁes the beginning and ending of the character string to be recognized and translated. In Figure 3, circles on both ends of thestring denote the user speciﬁed points. All the lo-cations ... delineated by rect-angles and have x,y coordinates (as shown in Fig-ure 2), the module considers all candidates and ratesthe arrangement of rectangles according to the dif-ferences in size and...

Báo cáo khoa học: Improvement of a monopartite ecdysone receptor gene switch and demonstration of its utility in regulation of transgene expression in plants pdf

... domain fused to a DNA-binding domain (DBD) and a ligand-binding domain(LBD). The chimeric gene (transactivation domain–DBD–LBD) is expressed under the control of a con-stitutive promoter. In ... germinate and grow on the inductionmedia for 20 days in the case of Arabidopsis and for4 weeks in the case of tobacco, at 25 °C, under 16 h oflight and 8 h of dark.MicroscopyThe transgenic Arabidopsis ... improvement in induction characteristics when compared to the switch containing wild-type EcR.Low background expression levels in the absence ofligand and high induced expression in the presenceof...

Báo cáo khoa học: Purple membrane lipid control of bacteriorhodopsin conformational ﬂexibility and photocycle activity An infrared spectroscopic study docx

... region containing the charged acidic amino acidsshould produce a strain limiting the mobility of both theamino-acid-containing loops and the attached transmem-brane a-helices. These interactions ... twists in the retinal structure and changes in its environment induced by a bacteriorho-dopsin conformational change, which produces alteredprotein–retinal interactions [25], while the decrease in ... 2MNaCl (Fig. 1, dash-dotline).Examination of the lineshape features of an infrared-active spectroscopic feature, such as the peak heights and bandwidths, provides insights into the molecular dynamicsof...

Báo cáo khoa học: Effects of a tryptophanyl substitution on the structure and antimicrobial activity of C-terminally truncated gaegurin 4 doc

... shape. In aqueous buffer, the CD spectraof the GGN4 analogues, including the native GGN4,showed a strong negative band near 200 nm and a weak and broad band around 222 nm, indicating a predominantlyrandom-coil ... structures in the 50% TFE/water mixture (gray lines) was superimposed over that in 500 mMSDS micelles (black lines), by matching the backbone atoms in residues I2V18,andthemainchain(N,Ca,C¢, and ... 5. Fluorescence quenching and blue shift. Fluorescence emissionspectra of NATA (a and b) and D16W-D24)37GGN4 (c and d) in water (a and c) and in 10 mMSDS micelles (b and d) were measuredwith...

Báo cáo khoa học: Starch-binding domains in the CBM45 family – low-afﬁnity domains from glucan, water dikinase and a-amylase involved in plastidial starch metabolism pptx

... 2011)doi:10.1111/j.1742-4658.2011.08043.xStarch-binding domains are noncatalytic carbohydrate-binding modulesthat mediate binding to granular starch. The starch-binding domains from the carbohydrate-binding module family ... 1185Starch-binding domains in the CBM45 family – low-afﬁnitydomains from glucan, water dikinase and a-amylaseinvolved in plastidial starch metabolismMikkel A. Glaring1,2, Martin J. Baumann1, ... starch-binding capacityof the noncatalytic SBD2 region and the interactionbetween the N- and C-terminal domains are involved in the modulation of the activity of starch synthase III from Arabidopsis...

Báo cáo khoa học: Ion-binding properties of Calnuc, Ca2+ versus Mg2+ – Calnuc adopts additional and unusual Ca2+-binding sites upon interaction with G-protein pdf

... dye (attenuating boththe J-band and the c-band), indicating that the dyebinds in the EF-hand motif. Binding of Mg2+causeda decrease only in the c-band, without disturbing theJ-band (Fig. 7A). ... upon binding with GDP-bound G-protein,whereas an increase in the J-band intensity was elicitedupon interaction of Calnuc and GTP-bound G-protein(Fig. 8B). Interestingly, why G-protein binding ... Ca2+-binding and Mg2+-binding thermograms before analysis of the datawith microcal origin 7.0.Protein–protein interactions and dissociation constantswere determined from the binding isotherm...

Báo cáo khoa học: DNA-binding characteristics of the regulator SenR in response to phosphorylation by the sensor histidine autokinase SenS from Streptomyces reticuli doc

... operonencoding a proline dehydrogenase and a proline perm-ease [23]. PutR has been suggested to facilitate theDNA binding of CRP by direct protein–protein inter-action or to induce a change in DNA ... SenRbinding, EMSAs were done. For this purpose, a  100 bpfragment (containing or lacking binding site I) upstream offurS (up-furS2) was ampliﬁed from each of the correspond-ing plasmids, using ... of hbpS and ending at the 5¢-end of binding site III)F IIIEcofor GCCGAATTCCGCCGGACCGGATG (located upstream of hbpS and beginning at the 3¢-end of binding site III)IIPstrev For sequence and characteristics,...

Báo cáo khoa học: Alternative binding proteins: Afﬁbody binding proteins developed from a small three-helix bundle scaffold potx

... theKeywordsafﬁbody binding proteins; afﬁnitychromatography; combinatorial proteinengineering; in vivo imaging; peptidesynthesis; phage display; protein chips;protein–protein interactions; selection; ... immunoglobu-lin-binding [Fc binding (IgG) and Fab binding(VHIII)] bacterial receptin have, for several decades,been widely used for the detection and puriﬁcation ofantibodies from different sources. In ... residues, and canbe easily expressed in soluble and proteolytically stable forms in various host cells on its own or in fusion withother protein partners [6]. Inspiration from advances in protein...

Xem thêm