Báo cáo khoa học: A nonribosomal peptide synthetase (Pes1) confers protection against oxidative stress in Aspergillus fumigatus ppt

... GATGACCTGACCATCGGGAAGTTCATAGGA 5¢ flanking forward CTAGCTGGTGAAGCAATGTCTCCGCAACATTTGGCGACATGGTCTCATAT 5¢ flanking reverse GGCCGAGGAGCAGGACTGAGAATTCTTTGCGGTCTTCCTGAAGCTGACCACTGT 3¢ flanking forward CATTGTTTGAGGCGAATTCGATATCGAGGCTCAGAACCTCCCTGCGCAGACGCG 3¢ ... (5¢-to3¢) pes1 A2 forward GGCTCTGGAACTGAATAAAGCGAC pes1 A2 reverse GTCCCATATATCCGCTTGCAATCT pes1 A4 forward TCTGACTCCGTCGATAGCTAGCAT...

Ngày tải lên: 30/03/2014, 10:20

... Chimica Biologica and 2 Dipartimento di Biologia e Patologia Cellulare e Molecolare ‘L. Califano’, Universita ` di Napoli, Italy The dimeric structure of seminal ribonuclease (BS-RNase) is maintained ... detached labelled protein was then analyzed by SDS/PAGE followed by autoradio- graphy. The results shown in Fig. 2 indicate that MSSAE monomers upon binding to the cell surface associate in...

Ngày tải lên: 20/02/2014, 11:20

... clearly showed that the majority of the material constituted of a tetrasaccha- ride and a smaller amount of a tetrasaccharide-ribitol. The data shows that the AAT residue is indeed an acetamido-amino ... The phosphoethanolamine and phosphate groups were absent as a result of that all phosphate ester linkages were broken. From the 1 H-NMR spectrum it was clear that the fraction contain...

Ngày tải lên: 20/02/2014, 11:20

... classification accuracy on a classification task where the codes refer to the role a span of text plays in context. We evaluate these two approaches alone and in combination over the same ... designed, automatically extractable context ori- ented features. In all cases we are able to achieve a statistically significant improvement by adding context oriented features, and on...

Ngày tải lên: 20/02/2014, 12:20

... H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi H, Sakai H & Yamamoto K (1993) Isolation and characterization of recombinant human cathepsin E expressed in Chinese hamster ... Azuma T, Nakajima M, Yasuda K, Hayakumo T, Mukai H, Sakai T & Kawai K (2000) Clinical signifi- cance of cathepsin E in pancreatic juice in the diagnosis of pancreatic ductal adenocarcino...

Ngày tải lên: 07/03/2014, 09:20

... the tagging results would improve in quality. Generally in POS tagging, all tagging errors are regarded equally in importance. However, inter- category and intra-category errors should be distin- guished. ... extend informative features for POS tagging (Toutanova and Manning, 2000; Toutanova et al., 2003; Man- ning, 2011). In addition, various supervised meth- ods such as HMMs and CRF...

Ngày tải lên: 07/03/2014, 18:20

... should also include the storing of each level in a separate file. If these principles are observed, annotation data management (incl. level addition, removal and replacement, but also conver- sion into ... [A- Z].+’ will match sequences consisting of a definite article and a word beginning with a capital letter. Markables are the carriers of the actual annota- tion information. They c...

Ngày tải lên: 08/03/2014, 04:22

... little information is available to date on the PL protein-mediated organization of chro- matin, and what little information is available has come mainly from invertebrate organisms [20,27]. In this ... ultrastructure of chromatin in the histone containing spermatozoa of a teleost fish. Biol Cell 40, 87–92. 25 Ward WS & Coffey DS (1991) DNA packaging and organization in mammalian sp...

Ngày tải lên: 08/03/2014, 08:20

... protein, the cDNA encoding p16 was obtained from the psp54 (28) cDNA. The oligonucleotides used as primers were: 5¢-CCCCTCGA GATGTCTAGACAAAAAAAGAGTAG-3¢ and 5¢-CCC CTCGAGTCACACAACAGCACGAC-3¢.ThePCR product ... acetylated, while H 2A contains a mixture of acetylated and nonacet- ylated isoforms and H2B was not acetylated at all. The acetylation and AUT/PAGE analysis of histones was carried...

Ngày tải lên: 08/03/2014, 10:20

... comparable state-of-the-art statistical SDSs which appear in the literature. Crook and Lemon (2011) suggest that rather than the DM assuming that the user has a single narrowly constrained goal in ... original number of POMDP states. The intuition here is that if the value of taking an action in a given state has been preserved then planning is equally as reliable in the compresse...

Ngày tải lên: 08/03/2014, 21:20