Báo cáo khoa học: A nonribosomal peptide synthetase (Pes1) confers protection against oxidative stress in Aspergillus fumigatus ppt

Báo cáo khoa học: A nonribosomal peptide synthetase (Pes1) confers protection against oxidative stress in Aspergillus fumigatus ppt

Báo cáo khoa học: A nonribosomal peptide synthetase (Pes1) confers protection against oxidative stress in Aspergillus fumigatus ppt

... GATGACCTGACCATCGGGAAGTTCATAGGA 5¢ flanking forward CTAGCTGGTGAAGCAATGTCTCCGCAACATTTGGCGACATGGTCTCATAT 5¢ flanking reverse GGCCGAGGAGCAGGACTGAGAATTCTTTGCGGTCTTCCTGAAGCTGACCACTGT 3¢ flanking forward CATTGTTTGAGGCGAATTCGATATCGAGGCTCAGAACCTCCCTGCGCAGACGCG 3¢ ... (5¢-to3¢) pes1 A2 forward GGCTCTGGAACTGAATAAAGCGAC pes1 A2 reverse GTCCCATATATCCGCTTGCAATCT pes1 A4 forward TCTGACTCCGTCGATAGCTAGCAT...

Ngày tải lên: 30/03/2014, 10:20

16 361 0
Tài liệu Báo cáo khoa học: A role for the intersubunit disulfides of seminal RNase in the mechanism of its antitumor action docx

Tài liệu Báo cáo khoa học: A role for the intersubunit disulfides of seminal RNase in the mechanism of its antitumor action docx

... Chimica Biologica and 2 Dipartimento di Biologia e Patologia Cellulare e Molecolare ‘L. Califano’, Universita ` di Napoli, Italy The dimeric structure of seminal ribonuclease (BS-RNase) is maintained ... detached labelled protein was then analyzed by SDS/PAGE followed by autoradio- graphy. The results shown in Fig. 2 indicate that MSSAE monomers upon binding to the cell surface associate in...

Ngày tải lên: 20/02/2014, 11:20

8 605 0
Tài liệu Báo cáo khoa học: A unique variant of streptococcal group O-antigen (C-polysaccharide) that lacks phosphocholine ppt

Tài liệu Báo cáo khoa học: A unique variant of streptococcal group O-antigen (C-polysaccharide) that lacks phosphocholine ppt

... clearly showed that the majority of the material constituted of a tetrasaccha- ride and a smaller amount of a tetrasaccharide-ribitol. The data shows that the AAT residue is indeed an acetamido-amino ... The phosphoethanolamine and phosphate groups were absent as a result of that all phosphate ester linkages were broken. From the 1 H-NMR spectrum it was clear that the fraction contain...

Ngày tải lên: 20/02/2014, 11:20

6 546 0
Tài liệu Báo cáo khoa học: "A Feature Based Approach to Leveraging Context for Classifying Newsgroup Style Discussion Segments" pptx

Tài liệu Báo cáo khoa học: "A Feature Based Approach to Leveraging Context for Classifying Newsgroup Style Discussion Segments" pptx

... classification accuracy on a classification task where the codes refer to the role a span of text plays in context. We evaluate these two approaches alone and in combination over the same ... designed, automatically extractable context ori- ented features. In all cases we are able to achieve a statistically significant improvement by adding context oriented features, and on...

Ngày tải lên: 20/02/2014, 12:20

4 519 0
Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

... H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi H, Sakai H & Yamamoto K (1993) Isolation and characterization of recombinant human cathepsin E expressed in Chinese hamster ... Azuma T, Nakajima M, Yasuda K, Hayakumo T, Mukai H, Sakai T & Kawai K (2000) Clinical signifi- cance of cathepsin E in pancreatic juice in the diagnosis of pancreatic ductal adenocarcino...

Ngày tải lên: 07/03/2014, 09:20

12 645 0
Báo cáo khoa học: "A Cost Sensitive Part-of-Speech Tagging: Differentiating Serious Errors from Minor Errors" pptx

Báo cáo khoa học: "A Cost Sensitive Part-of-Speech Tagging: Differentiating Serious Errors from Minor Errors" pptx

... the tagging results would improve in quality. Generally in POS tagging, all tagging errors are regarded equally in importance. However, inter- category and intra-category errors should be distin- guished. ... extend informative features for POS tagging (Toutanova and Manning, 2000; Toutanova et al., 2003; Man- ning, 2011). In addition, various supervised meth- ods such as HMMs and CRF...

Ngày tải lên: 07/03/2014, 18:20

10 406 0
Báo cáo khoa học: "A Flexible Stand-Off Data Model with Query Language for Multi-Level Annotation" ppt

Báo cáo khoa học: "A Flexible Stand-Off Data Model with Query Language for Multi-Level Annotation" ppt

... should also include the storing of each level in a separate file. If these principles are observed, annotation data management (incl. level addition, removal and replacement, but also conver- sion into ... [A- Z].+’ will match sequences consisting of a definite article and a word beginning with a capital letter. Markables are the carriers of the actual annota- tion information. They c...

Ngày tải lên: 08/03/2014, 04:22

4 348 0
Báo cáo khoa học: A unique vertebrate histone H1-related protamine-like protein results in an unusual sperm chromatin organization pot

Báo cáo khoa học: A unique vertebrate histone H1-related protamine-like protein results in an unusual sperm chromatin organization pot

... little information is available to date on the PL protein-mediated organization of chro- matin, and what little information is available has come mainly from invertebrate organisms [20,27]. In this ... ultrastructure of chromatin in the histone containing spermatozoa of a teleost fish. Biol Cell 40, 87–92. 25 Ward WS & Coffey DS (1991) DNA packaging and organization in mammalian sp...

Ngày tải lên: 08/03/2014, 08:20

14 484 0
Báo cáo khoa học: A chromatin-associated protein from pea seeds preferentially binds histones H3 and H4 pptx

Báo cáo khoa học: A chromatin-associated protein from pea seeds preferentially binds histones H3 and H4 pptx

... protein, the cDNA encoding p16 was obtained from the psp54 (28) cDNA. The oligonucleotides used as primers were: 5¢-CCCCTCGA GATGTCTAGACAAAAAAAGAGTAG-3¢ and 5¢-CCC CTCGAGTCACACAACAGCACGAC-3¢.ThePCR product ... acetylated, while H 2A contains a mixture of acetylated and nonacet- ylated isoforms and H2B was not acetylated at all. The acetylation and AUT/PAGE analysis of histones was carried...

Ngày tải lên: 08/03/2014, 10:20

8 274 0
Báo cáo khoa học: "A Statistical Spoken Dialogue System using Complex User Goals and Value Directed Compression" pptx

Báo cáo khoa học: "A Statistical Spoken Dialogue System using Complex User Goals and Value Directed Compression" pptx

... comparable state-of-the-art statistical SDSs which appear in the literature. Crook and Lemon (2011) suggest that rather than the DM assuming that the user has a single narrowly constrained goal in ... original number of POMDP states. The intuition here is that if the value of taking an action in a given state has been preserved then planning is equally as reliable in the compresse...

Ngày tải lên: 08/03/2014, 21:20

5 331 0
w